ID: 956927201

View in Genome Browser
Species Human (GRCh38)
Location 3:74002330-74002352
Sequence TAGAGACACAACTCACAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956927193_956927201 27 Left 956927193 3:74002280-74002302 CCAACACTTTGCTCAATTACCTG No data
Right 956927201 3:74002330-74002352 TAGAGACACAACTCACAGGCTGG No data
956927195_956927201 -7 Left 956927195 3:74002314-74002336 CCATCCCTCCCTGACATAGAGAC No data
Right 956927201 3:74002330-74002352 TAGAGACACAACTCACAGGCTGG No data
956927194_956927201 8 Left 956927194 3:74002299-74002321 CCTGAACGTTCTACTCCATCCCT No data
Right 956927201 3:74002330-74002352 TAGAGACACAACTCACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956927201 Original CRISPR TAGAGACACAACTCACAGGC TGG Intergenic
No off target data available for this crispr