ID: 956933417

View in Genome Browser
Species Human (GRCh38)
Location 3:74072223-74072245
Sequence GGTGTAGCCCAGAAATTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956933412_956933417 28 Left 956933412 3:74072172-74072194 CCAGCATCATGAATGTGTTAAGG No data
Right 956933417 3:74072223-74072245 GGTGTAGCCCAGAAATTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956933417 Original CRISPR GGTGTAGCCCAGAAATTTGG AGG Intergenic
No off target data available for this crispr