ID: 956941382

View in Genome Browser
Species Human (GRCh38)
Location 3:74165766-74165788
Sequence TTCCAGCTATAATACCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956941380_956941382 30 Left 956941380 3:74165713-74165735 CCACTTACAAATTCATTATTTGA No data
Right 956941382 3:74165766-74165788 TTCCAGCTATAATACCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956941382 Original CRISPR TTCCAGCTATAATACCTGGA TGG Intergenic
No off target data available for this crispr