ID: 956944471

View in Genome Browser
Species Human (GRCh38)
Location 3:74203986-74204008
Sequence GCAGCTTTTAAGTATTAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956944467_956944471 20 Left 956944467 3:74203943-74203965 CCTTAGAATGTTAATATAAAATA No data
Right 956944471 3:74203986-74204008 GCAGCTTTTAAGTATTAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956944471 Original CRISPR GCAGCTTTTAAGTATTAAGA TGG Intergenic
No off target data available for this crispr