ID: 956945619

View in Genome Browser
Species Human (GRCh38)
Location 3:74218949-74218971
Sequence GTGTGCTGGTAGGAGTGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956945616_956945619 10 Left 956945616 3:74218916-74218938 CCATCTGCATAAAAATGTTCAGT No data
Right 956945619 3:74218949-74218971 GTGTGCTGGTAGGAGTGTGTAGG No data
956945614_956945619 28 Left 956945614 3:74218898-74218920 CCTCCTGTAATCTGATTTCCATC No data
Right 956945619 3:74218949-74218971 GTGTGCTGGTAGGAGTGTGTAGG No data
956945615_956945619 25 Left 956945615 3:74218901-74218923 CCTGTAATCTGATTTCCATCTGC No data
Right 956945619 3:74218949-74218971 GTGTGCTGGTAGGAGTGTGTAGG No data
956945613_956945619 29 Left 956945613 3:74218897-74218919 CCCTCCTGTAATCTGATTTCCAT No data
Right 956945619 3:74218949-74218971 GTGTGCTGGTAGGAGTGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956945619 Original CRISPR GTGTGCTGGTAGGAGTGTGT AGG Intergenic
No off target data available for this crispr