ID: 956948625

View in Genome Browser
Species Human (GRCh38)
Location 3:74253669-74253691
Sequence GGCTCAGGACTAGCTAGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956948617_956948625 20 Left 956948617 3:74253626-74253648 CCCAAGAGACCAACATGGGAGGT No data
Right 956948625 3:74253669-74253691 GGCTCAGGACTAGCTAGGCTAGG No data
956948622_956948625 -4 Left 956948622 3:74253650-74253672 CCAGCTCTTTTAAAGGCTAGGCT No data
Right 956948625 3:74253669-74253691 GGCTCAGGACTAGCTAGGCTAGG No data
956948618_956948625 19 Left 956948618 3:74253627-74253649 CCAAGAGACCAACATGGGAGGTG No data
Right 956948625 3:74253669-74253691 GGCTCAGGACTAGCTAGGCTAGG No data
956948619_956948625 11 Left 956948619 3:74253635-74253657 CCAACATGGGAGGTGCCAGCTCT No data
Right 956948625 3:74253669-74253691 GGCTCAGGACTAGCTAGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956948625 Original CRISPR GGCTCAGGACTAGCTAGGCT AGG Intergenic
No off target data available for this crispr