ID: 956949824

View in Genome Browser
Species Human (GRCh38)
Location 3:74269540-74269562
Sequence GATTATGTATGTACAGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 306}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956949824 Original CRISPR GATTATGTATGTACAGAAAT GGG (reversed) Intronic
901120802 1:6891746-6891768 GATTATTTATGTATTAAAATTGG - Intronic
901666499 1:10829145-10829167 GTTTTTGTTTTTACAGAAATAGG - Intergenic
906621354 1:47283371-47283393 GATTATGTTTAAGCAGAAATGGG + Intronic
906735437 1:48121918-48121940 AAATATGAATGAACAGAAATAGG - Intergenic
908681265 1:66664211-66664233 GATAATTTAAGCACAGAAATAGG + Intronic
909302779 1:74034914-74034936 AAATATGTATGTACATAATTTGG + Intronic
909924001 1:81416867-81416889 GATTATGTATGTAGTAAAACAGG + Intronic
910907348 1:92194638-92194660 GAATATTTATAGACAGAAATGGG - Intergenic
911461873 1:98201731-98201753 GATTAAGTCTGTATGGAAATGGG - Intergenic
911697344 1:100905984-100906006 GACTGTATATGTCCAGAAATGGG + Intronic
912006032 1:104902916-104902938 TATTATATATGTAGAGAAATAGG + Intergenic
912585337 1:110758979-110759001 GAGTATGAATTTACAGATATTGG - Intergenic
912944915 1:114076812-114076834 GATAATGTATGTAAAGAATTTGG + Intergenic
913137085 1:115901971-115901993 GGTTCTGTGGGTACAGAAATTGG - Intergenic
913174235 1:116259320-116259342 CATTATGTATGTAAAGAGTTTGG - Intergenic
914321244 1:146562692-146562714 GATTTTGTATATACACAAACAGG + Intergenic
914464738 1:147916770-147916792 CATTATCTATTTACAGAAATTGG + Intergenic
914509284 1:148317327-148317349 GATTGTATATCAACAGAAATGGG + Intergenic
915327642 1:155088995-155089017 GTTGATGTATGAGCAGAAATTGG + Intergenic
915769822 1:158408951-158408973 TATTATGTATGTATAGATAATGG - Intergenic
916297772 1:163238904-163238926 GATTATTTATGTTTAAAAATAGG + Intronic
918394081 1:184096148-184096170 CATGACATATGTACAGAAATAGG - Intergenic
918903518 1:190458177-190458199 AATTATTTCTGTACAGAAGTGGG - Intronic
919002316 1:191848259-191848281 GTGTATGTATGTACATATATAGG - Intergenic
919427906 1:197456804-197456826 GATTATGGACTTACAGAAACCGG - Intronic
919702267 1:200642936-200642958 GATCATGTATGTACAGTGGTGGG + Intronic
923261019 1:232268183-232268205 ATTTATTTATGTAAAGAAATGGG + Intergenic
923924437 1:238608751-238608773 GTTTGAGTATGTACAGATATAGG + Intergenic
924301886 1:242648029-242648051 TAGTAGGTATGGACAGAAATGGG + Intergenic
1062807297 10:432413-432435 GATTCTGTCTTTAAAGAAATTGG + Intronic
1063297413 10:4821004-4821026 GATTATACATGTACAAAAAGGGG - Intronic
1063714277 10:8512383-8512405 GATTATGTATGTAAAGCATCTGG + Intergenic
1064086668 10:12350338-12350360 CATGATGTAAGGACAGAAATGGG - Intronic
1065495834 10:26327031-26327053 GAATATTTATGGACAGAAAAAGG + Intergenic
1066435058 10:35390095-35390117 GATTATGTTTGTACAAAATATGG + Intronic
1067171445 10:43910223-43910245 GATTGTGTATGTATGGAACTAGG - Intergenic
1067457602 10:46431817-46431839 TATTATGTATGTCCAGAAACAGG + Intergenic
1067629597 10:47952817-47952839 TATTATGTATGTCCAGAAACAGG - Intergenic
1070595172 10:77827826-77827848 GCTTATTTATGTACAGTAATGGG - Intronic
1071422694 10:85516833-85516855 GAATATAAATGGACAGAAATAGG - Intergenic
1071512504 10:86271399-86271421 GATTAGGTATGTAGAGAAGCAGG + Intronic
1071866439 10:89739075-89739097 GATTAAGCAAGTACAGAAAGAGG + Exonic
1072560719 10:96571259-96571281 TATTAAATATGTACATAAATGGG + Intronic
1072776393 10:98200253-98200275 GATTGAGTATTTACAGCAATAGG + Intronic
1074075925 10:110124735-110124757 GATCTTGTAGGTAGAGAAATGGG + Intronic
1076290013 10:129338659-129338681 TATTTTGTATGTACATTAATGGG - Intergenic
1078555098 11:12318617-12318639 GCTTATGTCTGAATAGAAATAGG - Intronic
1078908101 11:15706181-15706203 GAATATTTATGGACAGAAAAAGG - Intergenic
1078926215 11:15877826-15877848 GATGATGCATGTACACATATTGG + Intergenic
1078943539 11:16036560-16036582 GATTCTGTAAGAATAGAAATTGG + Intronic
1079240555 11:18719600-18719622 GAGTATGTGTGTGCAGAACTGGG + Intronic
1079592328 11:22195065-22195087 TAGTGAGTATGTACAGAAATTGG - Intronic
1081251116 11:40835374-40835396 AAATATGTAAGTACAGAAATGGG - Intronic
1081497284 11:43627108-43627130 CATTATGAAGGCACAGAAATTGG + Intronic
1081580925 11:44351258-44351280 GATTTTGTTTGAAGAGAAATAGG + Intergenic
1085057795 11:73417468-73417490 GATTATATATATATAAAAATAGG - Intronic
1085140510 11:74136611-74136633 GATTATGTATATAAAGCACTTGG + Intronic
1085685091 11:78614328-78614350 GGTTATGTAAGCAGAGAAATGGG - Intergenic
1086021573 11:82237274-82237296 GAGTATTTATGAACAGAAAAAGG - Intergenic
1086829971 11:91550051-91550073 AATTATGCATGTACAAAAACAGG + Intergenic
1089164310 11:116462781-116462803 GATGATGTATTTAAAGAACTTGG - Intergenic
1089830879 11:121326926-121326948 GATTATGTATGGAGAGGATTTGG - Intergenic
1089948637 11:122504888-122504910 GATTCTTTATCTACAAAAATGGG + Intergenic
1090272081 11:125393869-125393891 GATTATGTAGGTAGAGGAAGTGG - Intronic
1090421091 11:126575429-126575451 GATAATGTATGTACAATACTGGG + Intronic
1090544094 11:127743722-127743744 GGTCATGCATGTAAAGAAATAGG - Intergenic
1091278341 11:134367450-134367472 GATTATCTGTGTGCAGAAGTTGG + Intronic
1092537258 12:9402316-9402338 GATTATGTAAATACACAAAACGG + Intergenic
1092557420 12:9570981-9571003 GATTATGTAAATACACAAAACGG - Intergenic
1094240438 12:28216571-28216593 GGTTTTGTATGTAGAGAAGTTGG + Intronic
1100205482 12:92345002-92345024 GATTATGTATGCACTATAATAGG + Intergenic
1100230953 12:92606953-92606975 GATAATGTGGGTACAGAACTTGG - Intergenic
1100758461 12:97778224-97778246 GAAGATGTATGGACAGAAAAAGG + Intergenic
1101294043 12:103402668-103402690 GGTTATGAAGGTACAGACATAGG + Intronic
1101455993 12:104830900-104830922 GATTATGTAAGTACAAAGATAGG - Intronic
1101558327 12:105831709-105831731 TAGTATTTATATACAGAAATGGG - Intergenic
1104246342 12:127045714-127045736 GATTATAAATGTACAGGCATAGG + Intergenic
1105834625 13:24198349-24198371 GATTCTGTTTGTACAGGAGTGGG - Intronic
1106216071 13:27701056-27701078 GATTATGTCTTTTAAGAAATTGG + Intergenic
1106423548 13:29604177-29604199 GAGTATGTATATATAAAAATTGG - Intergenic
1107931277 13:45309703-45309725 TACTGTGTATGTACAGAAAAGGG - Intergenic
1108910498 13:55545061-55545083 GATTATATGAGTTCAGAAATGGG + Intergenic
1109584427 13:64379942-64379964 TATTATGTCTCTATAGAAATGGG - Intergenic
1109661748 13:65468562-65468584 GAATATGTCTTTCCAGAAATGGG + Intergenic
1109940294 13:69353668-69353690 GGTTATTTATTTACAGGAATGGG - Intergenic
1110084553 13:71361897-71361919 GATTATTTATTTACAAGAATTGG - Intergenic
1111486583 13:88909454-88909476 GATTAACTAAGTACTGAAATGGG + Intergenic
1112067160 13:95805413-95805435 GGATATGTATGTCCAGAAATAGG - Intronic
1112225647 13:97537362-97537384 GAAGATTTATGGACAGAAATAGG - Intergenic
1114242362 14:20880247-20880269 GATGATGCAAGTACAGACATCGG + Intergenic
1114427234 14:22634149-22634171 GATGATGTACGTATAGGAATAGG + Exonic
1115036425 14:28862564-28862586 GATTTTGTCTGTCCAGGAATTGG + Intergenic
1116089266 14:40284220-40284242 GATTATCCTTGTACAAAAATGGG + Intergenic
1116350065 14:43849849-43849871 GTATATGTATATACACAAATGGG + Intergenic
1117347375 14:54846560-54846582 GATTATGTTTAAACAAAAATGGG - Intronic
1120010604 14:79409398-79409420 CATTATGTATATACATATATAGG + Intronic
1120094900 14:80377482-80377504 GATTATTTGAGTACAGAAGTAGG + Intronic
1120410951 14:84154521-84154543 GATTATTTATGTATATTAATTGG + Intergenic
1120701152 14:87700300-87700322 ATATATGTATGAACAGAAATGGG - Intergenic
1123508027 15:20965071-20965093 GCTTCTATATGTACAGAAAGAGG + Intergenic
1123565245 15:21538813-21538835 GCTTCTATATGTACAGAAAGAGG + Intergenic
1123601508 15:21976100-21976122 GCTTCTATATGTACAGAAAGAGG + Intergenic
1124040333 15:26096123-26096145 GATGATTTATGGACAGAAAAAGG + Intergenic
1124651631 15:31478408-31478430 CATTCTGTATGTACATAATTAGG + Exonic
1127081221 15:55381761-55381783 CATTATTTATATAGAGAAATAGG - Intronic
1127253463 15:57267091-57267113 GAATATGTATGCCAAGAAATAGG - Intronic
1127653668 15:61035079-61035101 AATTATCTTTGTACAGTAATTGG + Intronic
1128464190 15:67895645-67895667 TATAATGTATGTACAGAAAAAGG + Intergenic
1130002286 15:80058350-80058372 TATTATGAATTTGCAGAAATTGG - Intergenic
1130078432 15:80710148-80710170 GGTTAGCTATGTGCAGAAATGGG + Intronic
1130300762 15:82678610-82678632 AATTATGCAGGGACAGAAATGGG - Intronic
1130329295 15:82908595-82908617 GAGTATGTATGGACAGAAAAGGG - Intronic
1130789682 15:87140493-87140515 GATTATGTTTGCATAAAAATGGG - Intergenic
1131668912 15:94598738-94598760 TATTATTTATATACAAAAATTGG + Intergenic
1202973616 15_KI270727v1_random:265919-265941 GCTTCTATATGTACAGAAAGAGG + Intergenic
1133472326 16:6087372-6087394 GTATATGTATCTACAGAAATAGG + Intronic
1133761804 16:8804781-8804803 GATTATGTGTTTCCAGAAAATGG + Exonic
1135253871 16:20924832-20924854 AATTATGTCTAAACAGAAATGGG + Exonic
1135265101 16:21018556-21018578 GACAATGTATGTAGTGAAATTGG + Intronic
1138779082 16:59760812-59760834 GATTATGTGTATACAAAAATAGG + Intergenic
1139456316 16:67080852-67080874 GATTAAGTAGGTAAAGAAAACGG + Intronic
1140012383 16:71148454-71148476 GATTTTGTATATACACAAACAGG - Intronic
1140565746 16:76039584-76039606 GATTATGTGTGTAGAGAGACTGG + Intergenic
1143470455 17:7171497-7171519 GATTACGTAAGTAGAGACATAGG - Intergenic
1146293724 17:31631766-31631788 GAGTATTTATGTACACAAAATGG + Intergenic
1148137494 17:45303705-45303727 GTTTATATATGTATAGTAATTGG - Intronic
1153118067 18:1685198-1685220 GATGATTTATGAACAGAAAAAGG + Intergenic
1153822468 18:8844068-8844090 AATTGTGTATGTCCAGATATAGG - Intergenic
1155900676 18:31385937-31385959 GTTTATGCATGTATACAAATAGG + Intronic
1156118215 18:33812698-33812720 GATTGTGTATTTCCAGGAATTGG - Intergenic
1156622928 18:38874071-38874093 GAATATGTATTTATATAAATAGG - Intergenic
1156625699 18:38905447-38905469 GAATATGTATGTATAAAAACAGG + Intergenic
1157153053 18:45238640-45238662 TATTATGCATGTAGATAAATAGG + Intronic
1158013498 18:52756475-52756497 GTTTATGTATGCACATATATGGG - Intronic
1158445258 18:57514616-57514638 TATTTTGGATATACAGAAATGGG - Intergenic
1158622616 18:59046214-59046236 GATAATGTATGTAAAGAACTTGG + Intergenic
1160305027 18:77724685-77724707 AATTATGTATGTATAGTAGTAGG - Intergenic
1162210186 19:9085115-9085137 GATTATGTAAGCCCAGGAATTGG + Intergenic
1167092704 19:47355484-47355506 GATTATGAATGCTCAGAAAATGG - Intronic
925210800 2:2044106-2044128 GAACATGTATGTACATTAATAGG - Intronic
925397025 2:3541546-3541568 GATTATTGATGTACACAAAATGG + Intronic
926417559 2:12664710-12664732 GATTATGCAGGTAAAGAAAGAGG + Intergenic
929203906 2:39268293-39268315 TAAAAAGTATGTACAGAAATGGG - Intronic
930251923 2:49044057-49044079 TATAATGTAGTTACAGAAATTGG - Intronic
930298079 2:49580092-49580114 TATTATATATGTAAACAAATAGG + Intergenic
930708758 2:54530249-54530271 GTTTATGTATCTAAGGAAATAGG + Intronic
931724719 2:65098357-65098379 TATGATGTATGTAAAGAATTTGG - Intronic
933251827 2:80037672-80037694 GATAGTGTATATACAAAAATGGG + Intronic
935153762 2:100463867-100463889 AGTTATGTATGTACAGATGTAGG - Intergenic
935205944 2:100896516-100896538 GATTATGTTTTTTCAGAACTTGG + Intronic
937812551 2:126215235-126215257 GATTGTGTAAGTCCACAAATAGG + Intergenic
939090513 2:137775256-137775278 GGTTTTGTATGTACATAAAATGG + Intergenic
940306842 2:152236042-152236064 TTTTATGCATGTTCAGAAATGGG + Intergenic
940554784 2:155210010-155210032 AATTATGCATGTACACAAATAGG + Intergenic
941033334 2:160538084-160538106 AATACTTTATGTACAGAAATTGG + Intergenic
941201345 2:162514551-162514573 GACAATGCAAGTACAGAAATTGG + Intronic
941645472 2:168035829-168035851 GATTTTGTAGGTAAAGAAAGAGG - Intronic
941718425 2:168787670-168787692 GAATATGCATTTACAGAAAGAGG + Intronic
941980416 2:171449677-171449699 AATTATGTATGTATTTAAATAGG + Intronic
942804259 2:179911223-179911245 AGTTATGTTTGTACATAAATGGG + Intergenic
943071437 2:183145430-183145452 GATTTTGTATTTACAGATTTGGG + Intronic
943965735 2:194329020-194329042 GAATATCTATGTAGAAAAATTGG - Intergenic
944797681 2:203204619-203204641 AGTTATTTATTTACAGAAATAGG + Intronic
945230309 2:207581777-207581799 GATTATGTAAGTAAAAAAACTGG - Intronic
945285266 2:208075799-208075821 AATTATGTATATAAAGAATTTGG + Intergenic
945315508 2:208366979-208367001 GATGATTTATGGACAGAAAAAGG - Intronic
945600269 2:211853910-211853932 GGTTATGTGTGTTCAGAAAAGGG + Intronic
945673448 2:212829860-212829882 AATTATGTTTATTCAGAAATAGG + Intergenic
946296660 2:218789435-218789457 GAAGATGTATGAACAGAAAAAGG + Intronic
946957824 2:224951275-224951297 GTTTATGTATATACACAGATAGG - Intronic
947559764 2:231138524-231138546 GAGAATATATGTACAGAAAGGGG - Intronic
1168864210 20:1071205-1071227 GATTATGTAAATATAAAAATGGG - Intergenic
1169497652 20:6130408-6130430 GATAATGTATGCAAAGAACTAGG - Intergenic
1169519864 20:6359458-6359480 GATGATTTATGGACAGAAAAAGG - Intergenic
1170105408 20:12750126-12750148 AAGTATGTAAGTACAGATATAGG - Intergenic
1170258661 20:14377095-14377117 CATTATATAGGTAAAGAAATGGG - Intronic
1172155112 20:32818959-32818981 GAGAATGTATGTACAGCCATTGG + Intergenic
1173015083 20:39217918-39217940 TATTGTGTATGTATAGAAAAAGG - Intergenic
1174023987 20:47556896-47556918 GTTTATATATGCACGGAAATGGG - Intronic
1174048443 20:47750303-47750325 GATTTTCTGTGTACAGAGATGGG - Intronic
1175656411 20:60774977-60774999 AATTATGTATTTGCAGAAATTGG + Intergenic
1175694846 20:61094289-61094311 GAATTTGTGTGTACACAAATGGG + Intergenic
1176780847 21:13192949-13192971 GAATCTGTATGTATAGGAATAGG - Intergenic
1178031585 21:28533287-28533309 GATTATGTCTTTGCAGGAATTGG + Intergenic
1183111150 22:35649511-35649533 GATTGTGTATCTGCAGAAGTTGG + Intronic
1183876285 22:40784988-40785010 GAATATTTATGGACAGAAAAAGG - Intronic
949410756 3:3761513-3761535 GATGATTTATGGACAGAAAAGGG + Intronic
950820837 3:15756725-15756747 GAATATGTATGGACAGGATTGGG + Intronic
952051417 3:29388935-29388957 GATGATGTGTCTACATAAATGGG - Intronic
954271495 3:49513328-49513350 GATTAGGTATTTCAAGAAATAGG + Intronic
954399864 3:50313409-50313431 GCTTATGTATGTACATAAACAGG - Intergenic
955866813 3:63392972-63392994 CCATAGGTATGTACAGAAATGGG - Intronic
956473374 3:69593081-69593103 GAGTATGTATGTATAGAGACGGG + Intergenic
956949824 3:74269540-74269562 GATTATGTATGTACAGAAATGGG - Intronic
957170161 3:76728392-76728414 GATTATTTAGGAAAAGAAATAGG - Intronic
957678881 3:83405567-83405589 GATAATGTATGTACATATATTGG - Intergenic
959112691 3:102140942-102140964 GATTATGGATGAACATAAAAGGG - Intronic
960534211 3:118798861-118798883 AATTCTGGATGTACAGATATTGG + Intergenic
962018131 3:131465538-131465560 AATCATGTATGTAGAAAAATAGG + Intronic
963280163 3:143376505-143376527 GATTATGTATATATACACATAGG + Intronic
964410935 3:156397303-156397325 GGTAATATATGTAAAGAAATTGG + Intronic
965346586 3:167558345-167558367 GATTATGTAGGTACTGAATTTGG + Intronic
965661867 3:171050529-171050551 GAGCATGTGGGTACAGAAATGGG - Intergenic
965787617 3:172352519-172352541 GATGATGTATAAACTGAAATAGG + Intronic
965889496 3:173493572-173493594 GTTTATGAATGTACAGGACTTGG - Intronic
966645355 3:182240533-182240555 GATCTTGTAAGTACAGAAAATGG + Intergenic
966679109 3:182621433-182621455 GAGTATTTATACACAGAAATTGG - Intergenic
967407186 3:189130137-189130159 CATGATGTATGTACAGATCTTGG + Intronic
971034239 4:22675755-22675777 GATTGTGTATTTACATCAATAGG - Intergenic
971166885 4:24192778-24192800 CATTATGTATGTATAAAAATAGG - Intergenic
971685892 4:29767472-29767494 GATTATGCAAGAACAGAAAGTGG - Intergenic
971844399 4:31899671-31899693 CATTTTGTATGTATAAAAATAGG + Intergenic
974589960 4:63933918-63933940 GATTTTGTATGTAGTGAAAAGGG - Intergenic
974856207 4:67464938-67464960 GATTATGTATGACTTGAAATTGG - Intergenic
976338078 4:83913706-83913728 CATTTTGGAAGTACAGAAATAGG + Intergenic
976426928 4:84914696-84914718 TAGTAAGTATGTAGAGAAATTGG + Intronic
978294736 4:107191749-107191771 GAAGATTTATGGACAGAAATAGG + Intronic
978318897 4:107471579-107471601 GATTATGTATGTAGAGACTGGGG - Intergenic
978881406 4:113707625-113707647 GATAAAGTATATGCAGAAATTGG - Intronic
979103295 4:116650839-116650861 GATGATTTAGGTACAGAAGTAGG + Intergenic
979266207 4:118705860-118705882 GGTTATGCATGTCAAGAAATAGG + Intronic
979374593 4:119931477-119931499 GACTATGTATGCCCAGAAAAAGG - Intergenic
979826504 4:125241093-125241115 TATTATGTCTCTACTGAAATGGG - Intergenic
979896095 4:126158923-126158945 CATTATGTATTTTCAGAAACTGG + Intergenic
982390658 4:154859974-154859996 AATTATGTATGCACAGACATGGG - Intergenic
983261624 4:165462985-165463007 GATTTTGTAAATGCAGAAATTGG + Intronic
984183881 4:176518891-176518913 GGTTATGATTGTACATAAATGGG - Intergenic
984565559 4:181326037-181326059 GAATAAGTATATACAGAAATAGG + Intergenic
984760512 4:183359043-183359065 AATTTTGTATGTATAGACATAGG + Intergenic
987633107 5:20502592-20502614 GAATATGTATTTACAGAACAGGG - Intronic
989058515 5:37387216-37387238 GATTATGAAGGATCAGAAATTGG - Intronic
989490727 5:42049368-42049390 GAGTATGTATGGACACAAAAAGG + Intergenic
990770399 5:59237367-59237389 AATAATGGATGTAAAGAAATTGG - Intronic
991117135 5:62967426-62967448 GAAGATTTATGGACAGAAATAGG - Intergenic
993126156 5:83838246-83838268 AATTATGTAGTTACAGGAATGGG - Intergenic
995292832 5:110478670-110478692 AATTCTGTATGTACAGCAAAGGG + Intronic
995499392 5:112787221-112787243 GATAATTTATGAACACAAATGGG + Intronic
995987192 5:118192112-118192134 GAATATTGATGCACAGAAATTGG + Intergenic
996837115 5:127805666-127805688 GATTATTTATGAACAGAAGCAGG + Intergenic
996862101 5:128079532-128079554 GATTATGAATGTATAGATTTTGG + Intergenic
997889838 5:137665956-137665978 GCTTATGTTTGTACACATATAGG - Intronic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
1000224464 5:159246592-159246614 GATTATATAAGTACTCAAATGGG + Intergenic
1000853660 5:166372027-166372049 GCATATGTAGGTACAGACATAGG - Intergenic
1003847822 6:10191790-10191812 GATTACATAAGTCCAGAAATTGG - Intronic
1004703945 6:18105235-18105257 GTTTATGTATGCACAAAATTTGG - Intergenic
1004993830 6:21169046-21169068 GATTATTTATGTGGAGAAAGTGG + Intronic
1007616555 6:43183000-43183022 GATCATGTATGTAAAGCACTTGG - Intronic
1008300705 6:49835608-49835630 GATCATGTATGAAAAGAAAAAGG + Intronic
1009479596 6:64140252-64140274 TATTAGATATGTACAGATATTGG - Intronic
1009821635 6:68810126-68810148 TATTATATATGAACATAAATGGG + Intronic
1011531637 6:88329140-88329162 GATTTTGTTTGGAAAGAAATTGG - Intergenic
1012532767 6:100258281-100258303 GATAATGTATGACCAGTAATAGG + Intergenic
1012716118 6:102672585-102672607 GATTATGCATTCCCAGAAATGGG - Intergenic
1012843493 6:104360768-104360790 GATGATGTATGGACAGAAAAAGG + Intergenic
1013677256 6:112479304-112479326 AATTATGTATATACTGAAATAGG - Intergenic
1014017899 6:116554743-116554765 GAATATATATATACAGAAAATGG - Intronic
1014055750 6:117013927-117013949 GGTTATATATTTCCAGAAATTGG - Intergenic
1015353418 6:132248982-132249004 TATTAAGTAGCTACAGAAATTGG + Intergenic
1018611477 6:165651779-165651801 GATTACATATGTACATATATAGG - Intronic
1020617555 7:10477941-10477963 GTTTATGTATGTATATAAAGAGG - Intergenic
1020966353 7:14874469-14874491 GATTTTGTAGATACAAAAATTGG - Intronic
1021721220 7:23506432-23506454 GATTATGTATGTAGGGAATAAGG - Intronic
1021755956 7:23852881-23852903 GCTTCTGTTTTTACAGAAATTGG + Intergenic
1021901184 7:25287475-25287497 GATGATTTATGGACAGAAAAAGG - Intergenic
1021964324 7:25902494-25902516 GAGTATGTAGGAACAGAAATGGG + Intergenic
1023215661 7:37859871-37859893 GATTATGGATGTGGAGCAATGGG - Intronic
1024475560 7:49804800-49804822 GGTTATGTATATAGAGAGATGGG - Intronic
1024517980 7:50276568-50276590 GATTATGTAAGTAAAGTGATTGG + Intergenic
1024979992 7:55149930-55149952 GTCTATGTATATACAGGAATTGG - Intronic
1026782476 7:73278677-73278699 GTGTATGTATGTACAGAGAGAGG - Intergenic
1027453129 7:78355689-78355711 ACTTATGTATGTACAGACATGGG + Intronic
1028223563 7:88223716-88223738 GCTCTTGGATGTACAGAAATAGG + Intronic
1028341866 7:89732245-89732267 GTTTATGTATGCACAGAATGTGG - Intergenic
1028854643 7:95576992-95577014 GAATTTTTATGTTCAGAAATAGG + Intergenic
1028956001 7:96691135-96691157 GTTTATGTATTAAGAGAAATAGG - Intronic
1029066638 7:97856223-97856245 GATAATGTATCTACTGAGATTGG - Intronic
1030123873 7:106136361-106136383 GATTATCTAAGAATAGAAATGGG - Intergenic
1031745663 7:125494883-125494905 TATTATTTATGTATGGAAATTGG + Intergenic
1031876284 7:127145258-127145280 GACTATGTAAGTACATAAAAGGG - Intronic
1033816144 7:145075902-145075924 TATTATGAATGTTCAGAGATTGG - Intergenic
1038072298 8:24030587-24030609 GAGTATGTATGTAAAGAGAATGG + Intergenic
1039381263 8:37087663-37087685 GATTATTTATGGACAGAAAAAGG - Intergenic
1041138082 8:54782370-54782392 GTTTATGTATATACAGACAGTGG + Intergenic
1041226702 8:55707319-55707341 GATTTTCTATGTACAGGAACTGG - Intronic
1042744085 8:72086408-72086430 AATTATGTGTGTACAGAATGCGG - Intronic
1043431777 8:80202016-80202038 GAACATGTATGGACAGAAAAAGG + Intronic
1043842433 8:85124134-85124156 AATTATGAAAGTACAGATATTGG - Intronic
1044097480 8:88086021-88086043 TATTGTTTATGTATAGAAATTGG - Intronic
1044316982 8:90761256-90761278 GATGATTTATGGACAGAAAAAGG - Intronic
1044398154 8:91738385-91738407 GATAATGTATGTAAAGAGTTTGG - Intergenic
1045148594 8:99376950-99376972 CATTAGGTATGTATAAAAATAGG + Intronic
1047009983 8:120661871-120661893 GTTTATGTATGTTCAGAGAATGG + Intronic
1047774197 8:128055956-128055978 CAATATGCATGTACAGAAATGGG + Intergenic
1050824162 9:9923142-9923164 GTGTGTGTATGTACAGAAAAAGG + Intronic
1052230712 9:26148013-26148035 CATTATGTATTCATAGAAATAGG - Intergenic
1052969727 9:34370120-34370142 GCCCATGTATGTACACAAATGGG + Exonic
1055048051 9:71951262-71951284 AATTATGTATGTACTGAAGGAGG + Intronic
1055136607 9:72836548-72836570 GATTCAGTATGAAAAGAAATAGG + Intergenic
1055543308 9:77338547-77338569 GATTGTGTATGTAAAGGATTTGG + Intronic
1055906368 9:81298764-81298786 GATTGTGTCTTTACAGGAATTGG - Intergenic
1056130399 9:83580394-83580416 GATAATGTATGTCCAGACAATGG + Intergenic
1058385698 9:104432492-104432514 GATTATGTAGGTGCTGAACTTGG + Intergenic
1058937796 9:109785177-109785199 GTTTATATATGTGCGGAAATAGG + Intronic
1059773315 9:117448515-117448537 GATGATGTGTGTAAAGAACTTGG - Intergenic
1059799190 9:117732407-117732429 GATTATGCTTAGACAGAAATTGG - Intergenic
1061051691 9:128200178-128200200 CATTTTGTTTTTACAGAAATGGG - Intronic
1061643432 9:131978854-131978876 AATTGTGTATGTACAGAACTTGG + Intronic
1186338921 X:8622523-8622545 GATTATCTTTGAACAGAACTGGG - Intronic
1186631937 X:11359027-11359049 AATTCTGTATGTAAAAAAATGGG + Intronic
1186643104 X:11478208-11478230 GAGTATGTATGTCCACAAAAAGG + Intronic
1187298275 X:18023850-18023872 CATTATATCTATACAGAAATAGG - Intergenic
1189469865 X:41305414-41305436 GTTTATGTGTGCACAGAAAAAGG - Intergenic
1189637696 X:43028840-43028862 AATTTTGTATTTACAGTAATCGG + Intergenic
1190417519 X:50195208-50195230 GACTATGTATGTTCATAAATTGG + Intronic
1190430300 X:50372212-50372234 AATTATGTATGTACAGTGCTTGG - Intronic
1190632725 X:52403755-52403777 GATAATGTCAGTACAGAAACAGG + Intergenic
1191042106 X:56093441-56093463 AATTATGTATGTAACAAAATTGG + Intergenic
1191097854 X:56692889-56692911 GATTATGTTTCCTCAGAAATTGG - Intergenic
1193668510 X:84354113-84354135 GATTATTTATGTGCAAAATTAGG + Intronic
1193787617 X:85778778-85778800 GAGTAGGGATGAACAGAAATAGG - Intergenic
1194138621 X:90179376-90179398 GATGATTTATGGACAGAAAAAGG + Intergenic
1194167241 X:90533043-90533065 CATTATCTATGTTGAGAAATGGG + Intergenic
1194828541 X:98593270-98593292 GAATATTTATGGACAGAAAAAGG + Intergenic
1194845742 X:98806715-98806737 GATTATGTATGTGCACCAAGGGG - Intergenic
1195471739 X:105238070-105238092 GAATATTTATGGACAGAAAAAGG + Intronic
1196244552 X:113385248-113385270 TATTATGTATGTATAAAAAGTGG - Intergenic
1197716631 X:129712986-129713008 GAAAATTTATGTACAGAAAAAGG + Intergenic
1198021213 X:132659937-132659959 GTTAATGCATGTAAAGAAATGGG - Intronic
1198722137 X:139634611-139634633 GATTATCAATATACATAAATTGG + Intronic
1198847653 X:140930040-140930062 GCATATGTATGTATAGAAAAAGG - Intergenic
1199163369 X:144641350-144641372 GATTTTATATGTACACATATTGG + Intergenic
1199484808 X:148336069-148336091 AATTATTTATGTACATAAACAGG + Intergenic
1200484423 Y:3749611-3749633 GATGATTTATGGACAGAAAAAGG + Intergenic
1200513504 Y:4110819-4110841 CATTATCTATGTTGAGAAATGGG + Intergenic
1200932958 Y:8713918-8713940 AAGTATTTATGTACAGAAACTGG - Intergenic
1201379283 Y:13355548-13355570 GTTTCAGTATGTAAAGAAATCGG + Intronic