ID: 956951268

View in Genome Browser
Species Human (GRCh38)
Location 3:74286065-74286087
Sequence TATGCTAATTTGGATTTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 1, 2: 5, 3: 18, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956951268 Original CRISPR TATGCTAATTTGGATTTGAT AGG Intronic
902316147 1:15620129-15620151 TATGCTAATTTGGCTTGGGAAGG - Intronic
902734451 1:18390986-18391008 TATGCTAATTAGATTTTAATGGG - Intergenic
904372114 1:30055580-30055602 TATCCTACTTTGAATTTGTTGGG - Intergenic
908870046 1:68599992-68600014 TTTGCTATTTTGGATGTGCTGGG + Intergenic
909267078 1:73574025-73574047 TAAGCTAATATGTAGTTGATAGG - Intergenic
909335651 1:74470163-74470185 TATTCTATTTTGGGTTTCATGGG + Exonic
909761374 1:79291546-79291568 TAGGCGTATTTGGATTTGGTAGG - Intergenic
911784547 1:101929634-101929656 TATTCTAAATTTGATTTTATAGG - Intronic
911985689 1:104618978-104619000 TATGCTCATCTGGAATTAATTGG - Intergenic
912175645 1:107152666-107152688 TTTCCTAATTTAGTTTTGATTGG - Intronic
914229343 1:145750982-145751004 TATGTTCATTTTAATTTGATTGG - Intronic
914252588 1:145933935-145933957 TTGGCTCTTTTGGATTTGATAGG - Exonic
914941018 1:152023107-152023129 TATTATGATTTGGATTTGAAGGG + Intergenic
915226238 1:154413691-154413713 AATGCTAATTTTATTTTGATTGG + Intronic
916547473 1:165819378-165819400 TTTGCTATTTTTGATTTGGTTGG - Intronic
917407839 1:174727376-174727398 AATGCTGATTCGGATTTTATTGG + Intronic
918432443 1:184476015-184476037 TATGGCAATTTGTATTTGCTTGG + Intronic
919018195 1:192068379-192068401 TGTGCAAGTTTGGATTTGAGGGG - Intergenic
920000332 1:202793703-202793725 TAAGATAATTTGGTTTTGAGGGG - Intronic
920551750 1:206867462-206867484 TATGCGACTTTGGCATTGATTGG + Intronic
923930559 1:238690568-238690590 TATGGCAAGTTTGATTTGATTGG - Intergenic
1063736638 10:8763261-8763283 AATGCTAATCTTGATTTGATTGG - Intergenic
1064952319 10:20866651-20866673 TTAGCTAATTTGGATTTAATGGG - Intronic
1065717521 10:28586857-28586879 TATGCCAATTTTGATTTGCTGGG + Intronic
1068339294 10:55681078-55681100 TATGCTACTTTCTATTTCATTGG + Intergenic
1068997856 10:63227949-63227971 TTTGCTAATAAGGATTTGCTGGG + Intronic
1073801067 10:107042442-107042464 TATGCTAACTTGGATCTGTTGGG + Intronic
1075964606 10:126600494-126600516 TTTGCTCATTTGCATTTGATTGG - Intronic
1076826095 10:132970318-132970340 TATTCTGCTTTGGATTTGCTGGG + Intergenic
1079476995 11:20841544-20841566 TATGCTAATTTGCATCTGATTGG - Intronic
1080085049 11:28269866-28269888 TATTTTAAATTGGATCTGATGGG + Intronic
1084709371 11:70834557-70834579 GATGCTATTTTGGATCTGGTGGG - Intronic
1084724455 11:70931925-70931947 TATGCTAATTTCGAATTGCTAGG - Intronic
1085597691 11:77824871-77824893 AATGCTAATTGGGATTATATAGG - Intronic
1086657384 11:89376124-89376146 AATGCTAATCTGGTTTTGAACGG + Intronic
1087184730 11:95176995-95177017 TATGATAATTAGAATTTAATCGG - Intronic
1087412215 11:97806883-97806905 TAAGCCCATCTGGATTTGATGGG + Intergenic
1087413985 11:97829032-97829054 TATAGTAATTTGGTTTTTATTGG + Intergenic
1088959641 11:114650314-114650336 TGTGCTAATTTGGAATAGCTGGG + Intergenic
1088995897 11:114996512-114996534 GCTGCTAATTTGGATAGGATGGG - Intergenic
1090514871 11:127413756-127413778 TATGATAATTTGGATATTAAAGG + Intergenic
1091032721 11:132205296-132205318 CATCCTGATTTGGATTTAATAGG + Intronic
1093408601 12:18838135-18838157 TTTGCTATTTTCTATTTGATTGG - Intergenic
1093411526 12:18874180-18874202 TGTGCTAATTTTCATTTAATTGG - Intergenic
1095178662 12:39122504-39122526 TATACTAATTTTGTTTTGATTGG + Intergenic
1097046809 12:56193069-56193091 TGTGCAAATTGGGATTTGGTAGG - Intergenic
1098119071 12:67216283-67216305 TAGGCTACTTTAGATTGGATGGG + Intergenic
1098139136 12:67433716-67433738 TTTGTTAATTTGCATTTAATTGG + Intergenic
1098352881 12:69582436-69582458 TATCGTAATTTGTATTAGATAGG - Intergenic
1098375747 12:69811928-69811950 TATGCTAATTTTGCATTGATGGG + Intronic
1098824017 12:75270491-75270513 TATGGTAATTTGGACTAGCTAGG - Intergenic
1099097449 12:78392330-78392352 TATGTTAATTTGGTTTTTGTTGG - Intergenic
1099798456 12:87427663-87427685 TATGCTTTTTTTGGTTTGATAGG - Intergenic
1100000161 12:89824306-89824328 TGTGGTAATTTTGATATGATAGG + Intergenic
1100844111 12:98642544-98642566 TATGTTAATTTTGATCTGAAAGG - Intronic
1100928013 12:99571941-99571963 TATACATATTTGGATTTTATTGG - Intronic
1105647482 13:22337291-22337313 GTTTCTAATTTGGTTTTGATGGG - Intergenic
1107590198 13:41896630-41896652 GGTGCTAATTTGCATTTTATAGG - Intronic
1108531924 13:51335414-51335436 TCTGTTAATTTGGATTTGATGGG - Intergenic
1108642964 13:52399907-52399929 CATACTAATTTGGATCTGAAGGG + Intronic
1110392032 13:74984930-74984952 CATGCTACTTTGGAAATGATGGG - Intergenic
1110667425 13:78134426-78134448 TATTCCAATGTGGATTTTATGGG - Intergenic
1110777131 13:79421140-79421162 TTTGGTAATTATGATTTGATAGG + Intergenic
1111605784 13:90537358-90537380 AATGCAAATTTGGTTTTCATAGG - Intergenic
1112384472 13:98925645-98925667 CATGCTACTTTGGTATTGATAGG - Intronic
1112821288 13:103339225-103339247 CATGCTATTTTGGTTATGATAGG - Intergenic
1114766967 14:25384091-25384113 AATGCTAATTTGTTTTGGATTGG - Intergenic
1116294096 14:43083313-43083335 TTTGCCCACTTGGATTTGATAGG + Intergenic
1117196662 14:53346504-53346526 TATGCAAACTTGAATATGATTGG + Intergenic
1121200488 14:92112854-92112876 CATGCGAGTTTGGATTTAATAGG - Intergenic
1123167339 14:106338479-106338501 CATGCTAACTTTGATTTTATTGG - Intergenic
1123169958 14:106363188-106363210 CATGCTAACTTTGATTTTATTGG - Intergenic
1123634732 15:22292785-22292807 TTTGTTAATTTGGTTTTTATAGG + Intergenic
1129209048 15:74055272-74055294 CATGCTAATTTGGGGTTGAATGG - Intergenic
1129404532 15:75306992-75307014 CATGGTAATTTGGAGTTGAATGG + Intergenic
1129735682 15:77960640-77960662 CATGCTAATTTGGGGTTGAATGG - Intergenic
1129767220 15:78177956-78177978 TATGCAAACATGGATATGATGGG - Intronic
1129793476 15:78358320-78358342 TAAGCTAATGGAGATTTGATTGG - Intergenic
1129836226 15:78708802-78708824 CATGCTAATTTGGGGTTGAATGG + Intronic
1130511024 15:84589226-84589248 CATGCTAATTTGGGGTTGAATGG - Intergenic
1133405146 16:5518161-5518183 GTTTCTAATTTGGATTTTATTGG - Intergenic
1139652615 16:68370190-68370212 TCTGCTAATTTGGATTCGATTGG - Intronic
1148362123 17:47020261-47020283 CATGCTAGTTTGCATTTCATAGG + Intronic
1150444669 17:65219409-65219431 TATGCTATTTGGGATTTCAACGG - Intronic
1150775066 17:68074750-68074772 AATGATATTTTGGATTTGTTGGG + Intergenic
1151087134 17:71392754-71392776 AATGCTAATTTGGAATGGCTGGG - Intergenic
1155813696 18:30274875-30274897 TATGCAAATTTGTGTGTGATGGG - Intergenic
1157057680 18:44249979-44250001 CATGCTAATTTTGTTTTGTTTGG + Intergenic
1157225855 18:45863904-45863926 TATCCTACTTGGGATTTGCTGGG + Intronic
1157250405 18:46090495-46090517 TATGAAAATTTGTATTTGATTGG - Intronic
1157840906 18:50957501-50957523 TATGCTAATTTGCAAATCATTGG + Intergenic
1158315394 18:56206838-56206860 TATGCTAATTTGGAGTTTATGGG - Intergenic
1163072371 19:14855017-14855039 TATGCTACCTTGGACTGGATGGG - Intergenic
1163816525 19:19468459-19468481 TATGCTATTTAGGGTTTGTTGGG - Intronic
1164429441 19:28174246-28174268 TACAGTAATTTTGATTTGATAGG - Intergenic
927388227 2:22561435-22561457 TATTGTAATTTGGAATTAATGGG - Intergenic
927391754 2:22604128-22604150 TATGCTAATTAGGCTTTGATTGG - Intergenic
927911640 2:26904002-26904024 AATGCTAATTTTGAGTTGGTGGG - Intronic
928266840 2:29819154-29819176 AATGCAAATTTGGATTCAATAGG - Intronic
929849030 2:45565088-45565110 CATGCCAATTGGGATTTGATAGG - Intronic
930501139 2:52219647-52219669 TATGGAAAGTTGAATTTGATAGG + Intergenic
931534552 2:63258885-63258907 TATGAGATTTTGGGTTTGATGGG - Intronic
936869819 2:117122748-117122770 GATATTAATTTGGATTTAATTGG + Intergenic
938137592 2:128771755-128771777 TATTCTAATTTGGAGGTGAGGGG + Intergenic
941412770 2:165180483-165180505 TAGGCTAGTTGGAATTTGATTGG + Intronic
942806356 2:179935848-179935870 TAAGCTACTTTGGTTTGGATTGG - Intergenic
942961940 2:181840352-181840374 TCATCTAATTTGGTTTTGATTGG + Intergenic
946779548 2:223178891-223178913 TATGCTAGTTTGGAGTTTATAGG + Intronic
946956858 2:224940426-224940448 TATGTTTATTTGGATTTGAATGG + Intronic
947552948 2:231060255-231060277 TATGCTACTTTAGTTTTGCTTGG + Intronic
1170492190 20:16888753-16888775 TATGCCGATATGGATTTGACAGG - Intergenic
1173137709 20:40454406-40454428 TGTTCTAATATAGATTTGATTGG - Intergenic
1174711000 20:52705431-52705453 TAAGGTAATTTGGTTTTAATGGG + Intergenic
1175097362 20:56552217-56552239 TTTGCTATTTTGGTTTTGGTGGG - Intergenic
1177467236 21:21501881-21501903 ATTGCTGATTTGGATTTGAATGG - Intronic
1182030201 22:27153161-27153183 TAACCTAATTTGGATTTCACTGG + Intergenic
951581121 3:24164525-24164547 TATACTAATGTTGATTTGCTAGG - Intronic
951926453 3:27913638-27913660 TATGCTAAGTTCGGTTTGACTGG - Intergenic
954959982 3:54555765-54555787 TAAGTTAATGTGGATTGGATAGG + Intronic
956951268 3:74286065-74286087 TATGCTAATTTGGATTTGATAGG + Intronic
957201598 3:77143032-77143054 TATTCAAATCTGGATTTGCTGGG - Intronic
964902675 3:161678541-161678563 CTTGTGAATTTGGATTTGATTGG + Intergenic
965136000 3:164769167-164769189 TATGAAAATATGGATTTCATTGG - Intergenic
965193225 3:165558523-165558545 TTTCCAAATTTGGATTTAATAGG - Intergenic
965656540 3:170990886-170990908 TGTGCTTATTTGGTTTTGTTTGG - Intergenic
969976895 4:11112468-11112490 TATGCTAATTGGCATGTGTTTGG + Intergenic
970048340 4:11882048-11882070 TTTGTTAATTTGTATTTGGTTGG - Intergenic
970083517 4:12318170-12318192 AATGTTAATTTGGTTTTTATTGG - Intergenic
971461080 4:26897446-26897468 TTTTCTAATTGGAATTTGATTGG + Intronic
971881149 4:32374789-32374811 TATGTTAATTTGCATTTTCTAGG + Intergenic
972236618 4:37141790-37141812 TATGCTCATATGGGTTTGAATGG + Intergenic
973587547 4:52408559-52408581 TTTGCTCATTTTCATTTGATTGG - Intergenic
974642117 4:64644614-64644636 TATATTAATTTGGAATTAATTGG - Intergenic
975332031 4:73127123-73127145 TATCTGAATTTGGATTTCATTGG - Intronic
978789820 4:112650048-112650070 TATCCTAATTTTGAATTCATAGG - Intronic
982210467 4:153030781-153030803 TATCCTATTTTGGGTTTGCTTGG - Intergenic
983702895 4:170620695-170620717 TATTCTGATTTGGATTTCTTGGG + Intergenic
984248810 4:177307475-177307497 TATGCGAGTTTGCTTTTGATTGG + Intergenic
986024276 5:3835683-3835705 TATGCTTATTTGGAATTAAGTGG - Intergenic
986257977 5:6116901-6116923 TATGCCAGTTTGGAATTGAAAGG + Intergenic
986676697 5:10191686-10191708 TAAGCTAATTTGAATTTTGTGGG - Intergenic
986867275 5:12004376-12004398 TCTGCTAATTTTGATTTATTAGG - Intergenic
988373984 5:30409393-30409415 TATGCATATTTGGAGTTGATAGG + Intergenic
988458595 5:31411488-31411510 GATGCTAATTTTGATATTATAGG + Intronic
988570420 5:32359440-32359462 TATGCTAATATCTATTTAATGGG + Intronic
989780928 5:45263687-45263709 TATGATTATTTAGATTTAATTGG - Intronic
990593638 5:57291908-57291930 TATGTTAGTTTGGGTTTAATGGG - Intergenic
991510783 5:67374522-67374544 TTTGCTAATTTGCATATGAATGG - Intergenic
992014576 5:72562847-72562869 GATTCTAATTTGGAGATGATGGG + Intergenic
992460495 5:76954959-76954981 TTTGCTAATGTGGACTAGATTGG + Intronic
993501341 5:88671260-88671282 TATGCTAATTTGCATTCAAATGG + Intergenic
997096534 5:130919487-130919509 TATGCTTCTTTGGATTGAATTGG + Intergenic
999062323 5:148649425-148649447 AGTGCTAATGTGGATTTGAAAGG + Intronic
999178738 5:149653517-149653539 TCTGTTGATTTGGATTTGGTTGG - Intergenic
1001844712 5:174911475-174911497 CATGCTAATTTGGGTTTGAATGG - Intergenic
1005641840 6:27803498-27803520 TTTGTTAATTAGGATTTTATAGG - Intergenic
1006684089 6:35817637-35817659 TATCTCAATGTGGATTTGATTGG - Intronic
1008289006 6:49689295-49689317 TATATTAATTTGGTGTTGATTGG - Intergenic
1008705550 6:54154290-54154312 TTTGCTATTTTTGTTTTGATTGG - Intronic
1009485861 6:64220787-64220809 TATTTTAACTTGGATTAGATAGG + Intronic
1009694218 6:67078056-67078078 TATGCAAATTTATATTTCATAGG - Intergenic
1009881024 6:69566229-69566251 TATACTAATGTGCATTTGGTTGG - Intergenic
1009912341 6:69946410-69946432 TATGCTAATCCAGATATGATGGG - Intronic
1014408374 6:121081343-121081365 TATACTAATTTGGAATTTAATGG + Intronic
1015876246 6:137825692-137825714 TATGCTACAATGGATTTGTTTGG - Intergenic
1021089311 7:16463816-16463838 TTTAGTTATTTGGATTTGATAGG + Intronic
1022772587 7:33490209-33490231 TGTCCAAATTTGGATTTGAATGG - Intronic
1024095977 7:45983209-45983231 TATGGGAATTTGGATTTCCTTGG + Intergenic
1024312299 7:47980186-47980208 TATGCTAATAAGAATTTTATCGG - Intergenic
1024496268 7:50050205-50050227 TATCCTAATGTGATTTTGATGGG - Intronic
1024789228 7:52944332-52944354 GATTCTAATTAGGATTTGAGTGG - Intergenic
1028023001 7:85801584-85801606 AATGCTAATTTGGAGGTGTTAGG + Intergenic
1031138411 7:117912619-117912641 TATTCTAATATGCATTTGAAAGG - Intergenic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1033518326 7:142131750-142131772 CAGGCTAATTTTTATTTGATGGG + Intronic
1033608949 7:142947231-142947253 TATGCTAATTTGGGTTAGGCAGG + Intronic
1036714783 8:11110725-11110747 AATGAGAATTTGTATTTGATAGG - Intronic
1039014128 8:33127307-33127329 AATGCAAATTTTGACTTGATAGG - Intergenic
1039823271 8:41152519-41152541 CATGGTAACTAGGATTTGATGGG + Intergenic
1040847842 8:51863322-51863344 TATGATAATTTTGAATTGAATGG - Intronic
1041629329 8:60067609-60067631 TATGCTAACTTGGATAAAATTGG - Intergenic
1042932640 8:74029036-74029058 TATTCTAATTTGAATTAGGTTGG - Exonic
1043213996 8:77562253-77562275 CATTCTAAATTGGATTTGAAAGG + Intergenic
1045739848 8:105344237-105344259 AATGATAATAAGGATTTGATAGG - Intronic
1045999711 8:108405077-108405099 TGTGCAAATATGGATTGGATTGG - Intronic
1046086333 8:109440541-109440563 TATCATAATCTCGATTTGATTGG - Intronic
1050800799 9:9610551-9610573 TATGCTACCTTGGAATAGATGGG + Intronic
1052196264 9:25718606-25718628 TATGTTAACTTGGACTTAATGGG + Intergenic
1052532041 9:29698426-29698448 TAAGATAATTTTTATTTGATGGG + Intergenic
1053225792 9:36355778-36355800 TATACTAATTTGTATATGTTTGG + Intronic
1053437384 9:38085337-38085359 TCTGTCAATTTGGATTTGACTGG + Intergenic
1056364545 9:85890787-85890809 TATGCTAATTTGCATTTCTTTGG - Intergenic
1058573384 9:106372435-106372457 TATGCTAACTTGGATATGACTGG + Intergenic
1058817718 9:108700885-108700907 TATTCGAATTTGGATTGGAATGG + Intergenic
1059060250 9:111028465-111028487 TATACTCATTTCAATTTGATAGG - Intronic
1062079304 9:134612777-134612799 TATCCTAATTTGGATTTGATGGG - Intergenic
1186788398 X:12974434-12974456 TAAGGTAATTTGGAGTTTATAGG - Intergenic
1187677443 X:21730938-21730960 GGTGCTAATATTGATTTGATTGG + Intronic
1188104179 X:26129000-26129022 TAGGCTAATTTGGATATGGATGG - Intergenic
1190420755 X:50282066-50282088 TTTGCAGATTTTGATTTGATAGG + Intronic
1190570892 X:51780129-51780151 TATGGGATTTGGGATTTGATTGG - Intergenic
1197036127 X:121876250-121876272 TATTCTAATTTGGATTCAAGGGG - Intergenic
1197589972 X:128396584-128396606 TATGCTAATTTGGTATAAATAGG + Intergenic
1197631773 X:128869200-128869222 GAGGCTAATTTGGGATTGATGGG + Intergenic
1198806072 X:140496129-140496151 CTTGATAATCTGGATTTGATAGG + Intergenic
1199157750 X:144570708-144570730 TTTGCTAATTTTTATTTGATAGG + Intergenic
1200312383 X:155091252-155091274 TTTGCTAATTTAGATTGAATTGG - Intronic
1200415857 Y:2909096-2909118 AATGCTTATTTGTGTTTGATTGG - Intronic
1202192465 Y:22259285-22259307 TATTCTGATTTGGATTTGGTGGG + Intergenic