ID: 956952264

View in Genome Browser
Species Human (GRCh38)
Location 3:74296253-74296275
Sequence GAGGAGAAGAAAAATGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1666
Summary {0: 1, 1: 1, 2: 14, 3: 170, 4: 1480}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956952264 Original CRISPR GAGGAGAAGAAAAATGAGGG AGG Intronic
900120190 1:1045576-1045598 GAGGAGAAGCACAGTGATGGGGG - Intronic
900721083 1:4176183-4176205 CAGGAGAAGAATAGAGAGGGAGG - Intergenic
900867745 1:5280501-5280523 GAGGAGGACAAACATGAGGATGG + Intergenic
900979910 1:6040491-6040513 GAAGAAAAGCAAAATAAGGGAGG - Intronic
901120278 1:6886079-6886101 AAGGAAAACAAAAATAAGGGAGG - Intronic
901305873 1:8232339-8232361 GAAGAGGAGGAAAAAGAGGGAGG + Intergenic
901469194 1:9443890-9443912 GAGGTGAAGAACAGAGAGGGAGG - Intergenic
901755981 1:11441860-11441882 GAGGAGGAGGAAGATGAGGGAGG + Intergenic
901755986 1:11441879-11441901 GAGGAGGAGGAAAATGAGGGAGG + Intergenic
901813293 1:11779715-11779737 GAGAGGAAGAGAAAGGAGGGTGG + Intronic
901873329 1:12151479-12151501 GAGGAGGAGAAAGATGAGGTTGG - Intergenic
902105588 1:14033234-14033256 GAGGAGGAGAGAAACCAGGGTGG + Intergenic
902160888 1:14529591-14529613 GAGGACAGAAAAAATGAGGGAGG + Intergenic
902296470 1:15470533-15470555 TTGGAGATGTAAAATGAGGGGGG - Intronic
902299266 1:15489825-15489847 TTGGAGATGTAAAATGAGGGGGG - Intronic
902503000 1:16922831-16922853 GAGAAGAGGTAAAATGTGGGTGG - Intronic
902533697 1:17106760-17106782 TAGGAGAAGAAAGATGAGAGAGG + Intronic
902762923 1:18595972-18595994 AAGGGGAAGAAAAGTGATGGAGG + Intergenic
903352488 1:22726188-22726210 GAGAAGGAGAAAAAGGAGGAAGG - Intronic
903772170 1:25770805-25770827 GAGAAGAAAGAAAATGGGGGTGG - Intronic
904104715 1:28069575-28069597 AAGAAGAAAAAAAAAGAGGGTGG + Intronic
904286026 1:29453798-29453820 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
904294726 1:29512057-29512079 GAAGAGAAAAAAAAGGAGGTGGG + Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904319951 1:29690083-29690105 GAGGAGAAGGAAAGTGAGGAAGG + Intergenic
904406829 1:30296601-30296623 AAGGATAGGAAAAATGAGGCTGG + Intergenic
904415041 1:30355635-30355657 GAGGAGCAGAGAAATGCGGCAGG + Intergenic
904465680 1:30705938-30705960 CAGGAGAATAAGAATTAGGGAGG - Intergenic
904581678 1:31548476-31548498 GAGGAGAAGAGGGATGGGGGTGG + Intergenic
905002113 1:34680672-34680694 GAGGAATAGAAAGATGGGGGAGG + Intergenic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905448404 1:38042434-38042456 GAGGAGAAGAAAAAAGGAGCAGG + Intergenic
905810733 1:40911194-40911216 GAGGGCAAGGAAAATGAGGCTGG + Intergenic
905842160 1:41190780-41190802 GAAGAGAAAAAAGATGATGGTGG - Intronic
905942321 1:41873957-41873979 GAGGAGAAGGGAAGCGAGGGTGG - Intronic
905970292 1:42136753-42136775 GAGAAGGAGAAAAAGGAGGAGGG - Intergenic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906647384 1:47485230-47485252 GGGGAAGAGAACAATGAGGGGGG + Intergenic
906708082 1:47909543-47909565 GAGGAGAAGAAGGAAGAAGGAGG + Intronic
906747636 1:48232814-48232836 GAAGAGAAGAGAAAAGAGGGAGG + Intronic
907258504 1:53197895-53197917 GAGGAGAAGAGAAATTTGGGTGG - Intronic
907462521 1:54613427-54613449 GAAGGGAAGAAAAGGGAGGGAGG - Intronic
908390591 1:63679951-63679973 GAGGAGAAGCAAAAAGAGAAGGG - Intergenic
908427159 1:64018279-64018301 GAGAAGCAGGAAACTGAGGGAGG - Intronic
908436337 1:64110517-64110539 AAGCAGAAGAAAGATGAGGATGG - Intronic
908438036 1:64126126-64126148 CAGGTGAAGAAAAATGAGAATGG + Intronic
908793003 1:67801959-67801981 GTGAGGAAGAAAAAGGAGGGAGG + Intronic
909135272 1:71790981-71791003 GAGGAGGAGAAAAATAAGAGGGG + Intronic
909531223 1:76683954-76683976 GAGGAGCAGAGAAATAAGGCAGG - Intergenic
909742810 1:79053317-79053339 GAGGGAGAGAAAAAAGAGGGAGG - Intergenic
909779060 1:79520066-79520088 GAGGAGGAGAAAGAGGAGGAAGG + Intergenic
909779082 1:79520191-79520213 GAGGAGGAGAAAGAGGAGGAAGG + Intergenic
910474824 1:87595615-87595637 GGGGAGAGGAAAAAAGAGGAAGG - Intergenic
910510081 1:87993650-87993672 GAAGTTAAGAAAAATGAGGTTGG + Intergenic
910547982 1:88440797-88440819 GAGGAGAAGGAGAAAGAAGGAGG + Intergenic
910554593 1:88517405-88517427 GAAGAGAAGAAAGAAGAAGGAGG + Intergenic
910554595 1:88517427-88517449 GAAGAGAAGAAAGAAGAAGGAGG + Intergenic
910554597 1:88517449-88517471 GAAGAGAAGAAAGAAGAAGGAGG + Intergenic
910619453 1:89236585-89236607 GAGAACAAGAAAAAGCAGGGTGG - Intergenic
910620510 1:89248439-89248461 GAGGAGAGGAAAAAATAGGGAGG + Intergenic
910876722 1:91885576-91885598 GCGGAGAGGAAGAGTGAGGGCGG + Intronic
911060714 1:93745514-93745536 GAGGAGAAGAAAAATGGTGGGGG - Intronic
911366096 1:96939206-96939228 GATGAGTGGAAAAATGAGGATGG - Intergenic
911474309 1:98357482-98357504 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
911744988 1:101431706-101431728 GAGGAGGAGAAAAATAACCGAGG + Intergenic
911939151 1:104019721-104019743 GAGGAGAGGAAAAAGTGGGGAGG - Intergenic
911988092 1:104657342-104657364 GAGGAGAAGAAAAAGTAGGGAGG - Intergenic
912158635 1:106953347-106953369 GAGAAGAAGCAAAGTGAGAGAGG - Intergenic
912939599 1:114033241-114033263 GAGAAAAAGAAAAATGAAGCAGG - Intergenic
913032608 1:114924783-114924805 AAGGTGGGGAAAAATGAGGGTGG + Intronic
913059182 1:115189046-115189068 GAGAGGAAGAAAAATGTGGTGGG - Intergenic
913163947 1:116168387-116168409 GAGGAGTAGAACAAAGAGGCGGG + Intergenic
913288111 1:117246098-117246120 GAGGAGAGGAGAAGTGAGGCAGG - Intergenic
913450255 1:118988173-118988195 GAGGAGAGAAAAAGAGAGGGAGG - Intronic
913458209 1:119055724-119055746 GAGGAGGAGAAGAGGGAGGGAGG + Intronic
913534660 1:119759688-119759710 GAGGAGAGGAGAAATGGGAGAGG - Intronic
913586109 1:120277426-120277448 GAAGAGAAGGAAATAGAGGGTGG - Intergenic
913622077 1:120620943-120620965 GAAGAGAAGGAAATAGAGGGTGG + Intergenic
914244620 1:145876445-145876467 GAGGAGAAGGAAGAGAAGGGTGG + Intronic
914387827 1:147188941-147188963 GAGAAGAAGGAAAATGAAGTTGG + Intronic
914460328 1:147877868-147877890 GAGGATATGAAAAGTGAGGAAGG + Intergenic
914568118 1:148889284-148889306 GAAGAGAAGGAAATAGAGGGTGG - Intronic
914604706 1:149240965-149240987 GAAGAGAAGGAAATAGAGGGTGG + Intergenic
914835121 1:151200171-151200193 GAGAAGAAGAAAGATGGGTGGGG + Intronic
914913185 1:151802639-151802661 GAGGAGGAGGAAAAGGAGCGGGG + Exonic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915304790 1:154970952-154970974 GGGGAGAAGTAAAGTGGGGGTGG + Intronic
915324109 1:155071730-155071752 GGGAAGAAGAAAAAGGGGGGAGG - Intergenic
915736807 1:158090368-158090390 GGGGAGAGGAGAAAGGAGGGAGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915897041 1:159820180-159820202 GAGGAAGAGAAAGATGAGGATGG - Intergenic
916242913 1:162657796-162657818 GAGGAGAAGGGAAAAGAGGAAGG - Intronic
916421435 1:164641265-164641287 GAGAAGAAGAGAAATGGGAGTGG + Intronic
916474235 1:165153345-165153367 CAGGTGAAGAAAAAGGATGGTGG + Intergenic
916579739 1:166096666-166096688 GAGGACAAGAACATTGAGGCAGG - Intronic
916967215 1:169961666-169961688 GAGGAGGAGAAAGAAGAGGAGGG - Intronic
917329561 1:173868084-173868106 GATGAGAGGAAGATTGAGGGAGG - Intronic
917460107 1:175222205-175222227 GAGGAGAAGGAAGGAGAGGGAGG + Intergenic
917484529 1:175443704-175443726 GATGGGAAGAAAGAGGAGGGAGG + Intronic
917621115 1:176796908-176796930 GAAGAAAAGAAAATAGAGGGAGG - Intronic
917696275 1:177527489-177527511 GAGGAGAAGAAAGAAGAGTGAGG + Intergenic
917786082 1:178458674-178458696 GAGGAAAGGAAAAATTTGGGAGG + Intronic
918029703 1:180793829-180793851 GGAGAGAAAGAAAATGAGGGTGG - Intronic
918056397 1:181025323-181025345 GAGTAGAAGGAAAAGGATGGGGG + Intergenic
918132984 1:181645424-181645446 TATAAGAAGAAAAAAGAGGGTGG - Intronic
918234666 1:182569262-182569284 GAGGAGAAAAAAGTTTAGGGAGG - Intergenic
918278285 1:182976398-182976420 TAGCACAAGAAAAATGAGAGAGG + Intergenic
918689413 1:187461969-187461991 GAGGAAAAAAAAAATGGGTGTGG + Intergenic
918953574 1:191174388-191174410 GAGGAGGAGAACAAAGAGGAGGG + Intergenic
919008409 1:191928947-191928969 GAGGAGAGGAAAAAGAAGAGTGG + Intergenic
919021727 1:192114665-192114687 GAGAAAAGAAAAAATGAGGGAGG + Intergenic
919177004 1:194031684-194031706 GAGGAGAAGAAAGAGATGGGGGG - Intergenic
919291519 1:195639509-195639531 AAGAAAAAGAAAAAAGAGGGAGG - Intergenic
919547384 1:198940689-198940711 GAGGAGAAAAGGAATGAAGGGGG - Intergenic
919617890 1:199830254-199830276 GAGGAGAGAAAAAAGGAGAGAGG - Intergenic
919625495 1:199905917-199905939 AAAGACAAGAAAAATGAAGGAGG - Intergenic
919686582 1:200488593-200488615 GAGTAGGAAAAAAGTGAGGGAGG + Intergenic
919977344 1:202621259-202621281 AAGGAGAAAACAAATGAGGGGGG + Intronic
920032331 1:203044910-203044932 GAGAAGAAGAAAAGAGAAGGGGG - Intronic
920079412 1:203361502-203361524 GAGGAGGAGGGAGATGAGGGAGG - Intergenic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920535927 1:206736540-206736562 GAGGAGAGGAGATATGAGGCTGG + Intergenic
920952118 1:210582264-210582286 GGGGAGAAGGGAAATAAGGGTGG + Intronic
921263492 1:213404000-213404022 TAGGAGAAGGCAGATGAGGGAGG + Intergenic
921307541 1:213812179-213812201 GAAGTGAAGGAAAAGGAGGGAGG + Intergenic
921325938 1:213986339-213986361 AAGGAGAAAAAAAATTAGGTCGG - Intronic
921339946 1:214124698-214124720 GAGGAAATGAGAAATGGGGGTGG + Intergenic
921936213 1:220799503-220799525 CAGGAAAAGAGAAATGAGTGGGG + Intronic
921958369 1:221008085-221008107 GAGGAGGGGAAAAATGGGGATGG - Intergenic
922041944 1:221905265-221905287 GGAGACAAGAAGAATGAGGGTGG - Intergenic
922071007 1:222193453-222193475 GAGGAGCAGAAAAAAGGGTGTGG - Intergenic
922269379 1:224017809-224017831 GAGGAGAAAAAAAAGGTCGGTGG - Intergenic
922449006 1:225721596-225721618 GAGAAGAAAAAAACTGAGTGTGG + Intergenic
922564703 1:226594088-226594110 GAGGAGGAGGAAAACGAGGCAGG + Intronic
922658769 1:227410509-227410531 GAAAAGAAGAAAAGAGAGGGAGG - Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922710906 1:227831038-227831060 GAAAATAAGAAAAATGAGAGTGG - Intronic
922784461 1:228276184-228276206 GAGGGGAAGAGAGAGGAGGGAGG + Intronic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
922974318 1:229771020-229771042 TAGGAGAAAACAATTGAGGGAGG + Intergenic
923059623 1:230458902-230458924 GAGAAGGAGAAAAAGGAGTGAGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923345011 1:233043159-233043181 GAAGAGGAGAAAAATGAATGAGG - Intronic
923474185 1:234317380-234317402 GAGGAGAAGGGAAGTGAGGGGGG - Intronic
923658542 1:235939123-235939145 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
923706018 1:236345504-236345526 GGGGGGAAAGAAAATGAGGGTGG - Intergenic
923827449 1:237515981-237516003 GAAGAGAAAAAAGAAGAGGGAGG - Intronic
923865778 1:237938108-237938130 GAGCAGAACACAAGTGAGGGAGG + Intergenic
924339679 1:243017099-243017121 CAGGAGGAGAAAAGTGAGTGAGG - Intergenic
924628756 1:245717122-245717144 GAGGAGAGAAAAGAGGAGGGAGG + Intergenic
924802150 1:247335385-247335407 TAGGAGGAGGAAAGTGAGGGAGG + Intergenic
924918193 1:248596446-248596468 CAGGAGAACAAAAGTGAGAGTGG + Intergenic
1062791905 10:312198-312220 GAGGAGAAGAAAACAGAAGTTGG - Intronic
1062922888 10:1293189-1293211 CAGGAATAGAAAAAAGAGGGAGG + Intronic
1062945471 10:1457993-1458015 GAGCAGGAGAGAAAGGAGGGAGG - Intronic
1063201490 10:3788205-3788227 GAGGAGAAGAAAAACAGTGGAGG - Intergenic
1063241236 10:4171332-4171354 GAGGAAAAGTAAAACCAGGGTGG + Intergenic
1063286119 10:4690482-4690504 AAAGGGAAGAAAAATGAGGCAGG + Intergenic
1063306996 10:4911445-4911467 AAAGAGAAAAAAAGTGAGGGGGG - Intergenic
1063737928 10:8782323-8782345 AAGGAAAAGAAAAATGAAGGAGG + Intergenic
1063802155 10:9592477-9592499 GAGGAGAAGAATAATCACTGTGG + Intergenic
1063912637 10:10848025-10848047 GAGGGGAAGAGAAAGGAGAGAGG - Intergenic
1063924286 10:10962161-10962183 AAAGAAAAGAAAAAAGAGGGAGG + Intergenic
1063997045 10:11629233-11629255 GAAAAGAAGAATAATGAGGCCGG - Intergenic
1064056909 10:12105716-12105738 GAGGAAAAGATAAAAGAGGCTGG - Intronic
1064074100 10:12255167-12255189 TAGGAGGAGAAAACAGAGGGAGG - Intergenic
1064305158 10:14158807-14158829 GAAGAGAAGGAAGAAGAGGGAGG + Intronic
1064477378 10:15705776-15705798 GAGGTGAAGTGAAATGAGGATGG - Intronic
1064558054 10:16567088-16567110 GAGGTGATGAAAAATGACCGAGG - Intergenic
1064839393 10:19573518-19573540 GAAGAGAAAGAAAATGAGGGAGG - Intronic
1064993259 10:21274938-21274960 GAGGAGAAGGAAGAGGAGGAGGG + Intergenic
1065002296 10:21348050-21348072 CAGGTGAAGAAAAATGATGATGG - Intergenic
1065184252 10:23156865-23156887 AAGGAGAAGGAAAGAGAGGGAGG + Intergenic
1065408158 10:25391204-25391226 GTGCAGAAGGAAAATGTGGGTGG + Intronic
1065813578 10:29464490-29464512 GAGGAGGAGAAAAAGGTAGGAGG - Intronic
1065819789 10:29515079-29515101 GAGGAAAACAGAAATGAAGGGGG - Intronic
1065827613 10:29586187-29586209 GAAGAGAACAAAAAGGAGAGGGG + Intronic
1065953127 10:30669810-30669832 GAGGAAAACAGAAATGAAGGGGG + Intergenic
1066129736 10:32381298-32381320 GAGGAGGAGAAAGAAGAGGAGGG + Intergenic
1066347810 10:34606343-34606365 GAGGAGGAGAAAGATGAGGCTGG + Intronic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067254911 10:44627822-44627844 GAGAAAAAAAAAAAAGAGGGTGG + Intergenic
1067394616 10:45903045-45903067 GGGGAGAAGAAAGATGGGGCAGG + Intergenic
1067561411 10:47307295-47307317 GAGGGGAAGAAAAGAGAGGAGGG + Intronic
1067862939 10:49872176-49872198 GGGGAGAAGAAAGATGGGGCAGG + Intronic
1067878384 10:50024073-50024095 TGGGAGAAGGAAAAAGAGGGTGG - Intergenic
1067893338 10:50153855-50153877 TGGGAGAAGGAAAAAGAGGGTGG + Intergenic
1068724825 10:60289362-60289384 GGGGAGAAGAAGAAAGAGGGTGG - Intronic
1069098520 10:64289324-64289346 GGGGAGAAGAGAAATAAGAGAGG + Intergenic
1070225201 10:74496969-74496991 AAAGAGAAAAAAAATGAGAGAGG - Intronic
1070227332 10:74523432-74523454 GAGGAGAGGAGAAGTGATGGTGG - Intronic
1070350113 10:75583676-75583698 GAGGAGGAGAAAGCTGATGGTGG - Intronic
1070505943 10:77112805-77112827 GAAGAGAAGAAAAAAGGGCGGGG - Intronic
1070737607 10:78875020-78875042 GAAGAGAAGAGAGATGAGGGAGG - Intergenic
1070815735 10:79321925-79321947 GAAGAGATGAACAATGAGAGGGG - Intergenic
1070906335 10:80076762-80076784 GAGGAGAAGAATAAAGAGGGTGG + Intergenic
1070908803 10:80099533-80099555 GAGAAGAAAAGAAAGGAGGGAGG + Intergenic
1071033127 10:81207914-81207936 GAAGAGAGGAAAAATAGGGGTGG + Intergenic
1071129902 10:82378535-82378557 GAGTAGAAGAGAAGAGAGGGAGG - Intronic
1071324688 10:84501422-84501444 GAGGAGAAGGAGAAAGGGGGAGG - Intronic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071358846 10:84824849-84824871 GAGAAGAAGAGAAAGAAGGGAGG - Intergenic
1071483402 10:86081229-86081251 GAGGAGCAGAGAAATGGGGCTGG + Intronic
1072050842 10:91701481-91701503 GAAGAGAAGAAAGATGGGGCAGG + Intergenic
1072490103 10:95896798-95896820 GAAAAGAAGAAGAATAAGGGGGG - Intronic
1072846814 10:98840602-98840624 GAAGAGACAAAAAATGAGGAGGG + Intronic
1073028798 10:100508353-100508375 GAGAAGGAGGAAGATGAGGGAGG + Intronic
1073109249 10:101050945-101050967 GAAGACAAGAAAGATGAGGTGGG - Intergenic
1073654571 10:105399260-105399282 GAGGAGGATACAAATGGGGGTGG + Intergenic
1073682718 10:105721703-105721725 GGTGAGAAGGAAAATGAGAGAGG + Intergenic
1073736777 10:106356987-106357009 GAGGAAAAGTAAAAGGAAGGAGG - Intergenic
1073742538 10:106425035-106425057 GAGAAGAAGAAAAATTAAGCAGG + Intergenic
1073748233 10:106494270-106494292 GAGGAGAAGAAAAAAGAAAAAGG - Intergenic
1073855266 10:107666241-107666263 GAGGAGGAGAAAGAGGAGGAGGG - Intergenic
1074201796 10:111243967-111243989 AAGGAAAAGAAAAATGAGGGAGG + Intergenic
1074305957 10:112278726-112278748 GAGGGGAAGACAGATAAGGGAGG + Intergenic
1074373136 10:112916726-112916748 GAGAAGGTAAAAAATGAGGGTGG + Intergenic
1074378540 10:112959414-112959436 GAGGAAAAGAAAAATTAATGAGG + Intronic
1074570858 10:114622749-114622771 GAGGAGAAGGAAGAAGAGGAGGG - Intronic
1074691126 10:116005054-116005076 GAGGAGAAGGAGATGGAGGGGGG - Intergenic
1074814731 10:117135394-117135416 GAGGGGCAGAAGAATGAGAGGGG - Intronic
1074914482 10:117942175-117942197 GAGGAGGAGAAAACTGAAGGAGG - Intergenic
1075554313 10:123419161-123419183 GAGGAGAAGAGAAGAGAGGAGGG - Intergenic
1075757584 10:124826695-124826717 GAAGAGAAGAAAGACGAGGTCGG - Exonic
1075957248 10:126534672-126534694 ACGGAGTAGAAAAATGAAGGTGG - Intronic
1076077354 10:127545062-127545084 GAGGAGAGGGAAAAGGAGGGAGG - Intergenic
1076077460 10:127546375-127546397 CAAGAATAGAAAAATGAGGGGGG - Intergenic
1076256547 10:129031029-129031051 GGGGAGAAGAAAAATCAATGAGG + Intergenic
1076296589 10:129390507-129390529 GAGGAAAGGTAAAATGTGGGTGG + Intergenic
1076448879 10:130541472-130541494 AAGGAGAAGAAAAAGAGGGGAGG - Intergenic
1076809432 10:132878943-132878965 GAGGAGCAGGACAAGGAGGGGGG + Intronic
1077017806 11:404653-404675 GAGGAGAAGGCTAATGACGGAGG + Exonic
1077372050 11:2186956-2186978 GAGGAGACAAAAGATGAGGGCGG + Intergenic
1077392592 11:2306993-2307015 GAGGAGAAGAAAGAGGGGGAGGG + Intronic
1077531305 11:3096925-3096947 GAGGAGGAGAGGAAAGAGGGAGG + Intronic
1077695523 11:4389473-4389495 GAGGGGAATAAAAATGATGCAGG - Intronic
1077809721 11:5625003-5625025 GAGGTGAAGAAAAGCCAGGGTGG - Intronic
1077816460 11:5690590-5690612 GAAGAGAAGAAAAGTGAAGTGGG + Intronic
1078135795 11:8650450-8650472 GAGCAGAAGGAAAAGGAGGAAGG + Intronic
1078404742 11:11060535-11060557 GAAAAAAAGAAAAATGAGGTGGG + Intergenic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078442253 11:11377788-11377810 GAGGAAAAGACAGATGAGGATGG + Intronic
1078468146 11:11565524-11565546 GAGCAGAAGAAAAAGGAGGCTGG + Intronic
1078553027 11:12293453-12293475 GATGGGAAGAAAAAACAGGGAGG + Intronic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1078929372 11:15901457-15901479 GAGAAGAAGAAAAATAGGAGTGG + Intergenic
1079061332 11:17251531-17251553 GAGGAGAAGACAGGTCAGGGAGG + Intronic
1079373210 11:19869831-19869853 GCAGAGAAGAACAATGAGGAAGG + Intronic
1079822536 11:25148455-25148477 GACGAGAAGGGAAAGGAGGGAGG + Intergenic
1079990827 11:27244831-27244853 CAGGATAAGAAAGATGAGAGAGG + Intergenic
1080275620 11:30500284-30500306 GAGGAGAGGAAATATCAGAGAGG - Intronic
1080314057 11:30928188-30928210 GAGGAGAAGAAGTAAGAGAGAGG - Intronic
1080541746 11:33272814-33272836 GAGGGGAGGAAGAAAGAGGGAGG - Intronic
1080556795 11:33424865-33424887 GAGGAGGTGAAGAATGAGGTTGG + Intergenic
1080805617 11:35650607-35650629 GAGGAAAAAAAAAAGAAGGGAGG + Intergenic
1081331120 11:41801332-41801354 AAGGAGAAAACAAATGTGGGTGG - Intergenic
1081731202 11:45372842-45372864 TAGGACAAGAAAACTGTGGGTGG + Intergenic
1081867406 11:46367263-46367285 GAGGAGAAGACAGCTGAGGAGGG - Intronic
1082079296 11:47999778-47999800 AAGGAGAAGGAAAACTAGGGGGG + Intronic
1082762099 11:57136932-57136954 GAGGAGGAGGAAAAGGAAGGAGG + Intergenic
1082913489 11:58404518-58404540 GAGGAAAAGAAAATTGGAGGTGG - Intergenic
1083071940 11:59993648-59993670 GAGGAGAGGAGAAAGGAGAGTGG - Intergenic
1083254427 11:61487427-61487449 GTGGAGAAGAGGGATGAGGGAGG + Intronic
1083319678 11:61838109-61838131 GAGGAGAAGGAAAATGAAACTGG - Intronic
1083378436 11:62244641-62244663 TAGGAAAAGAAAAAAGAAGGTGG - Intronic
1083725511 11:64625951-64625973 GAGGAGAAGAGAGAAGAGTGGGG - Intronic
1083966822 11:66048609-66048631 GGGGAGGAGGAAAAAGAGGGAGG - Intronic
1084429633 11:69103940-69103962 GGGGAGAAGACACATGAAGGGGG - Intergenic
1084524013 11:69684795-69684817 GAGGAGAGGAAAAGCCAGGGAGG - Intergenic
1084679790 11:70660164-70660186 GAGGCCAAGAAATATGATGGCGG - Intronic
1084723088 11:70921496-70921518 AAGGAGTAGAAAAATGAATGAGG + Intronic
1085197615 11:74682034-74682056 GAGGAGGAGAACAAGGCGGGAGG - Intergenic
1085257785 11:75186062-75186084 GAGGGGTAGGAAAATGAGGCTGG - Intronic
1085633371 11:78138641-78138663 GAGAAAAAGAAAAAAGAGGAAGG + Intronic
1085858349 11:80202174-80202196 GTGAAGAAGAAATATGAAGGTGG + Intergenic
1086116449 11:83256552-83256574 GAAGAGAAGAGAAAAGAGAGGGG - Intronic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086266328 11:85002823-85002845 GAGGAGAAGAAAAGGAAGGTCGG - Intronic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086502192 11:87464819-87464841 GAGGAGAAGACACATGGGGAGGG + Intergenic
1086629356 11:88998036-88998058 CAGGAGAAGAAAAATATGAGAGG + Intronic
1086998899 11:93392923-93392945 GAGGAGGAGGAAGAGGAGGGAGG - Intronic
1086998906 11:93392945-93392967 GAGGAGGAGGAAGAGGAGGGAGG - Intronic
1087118731 11:94550598-94550620 GAGGAAAAGAAAGATGGGGGTGG + Intronic
1087414707 11:97839309-97839331 GAAGAAAAGGAAAAGGAGGGTGG + Intergenic
1087541131 11:99521636-99521658 GAGGAGGACAAAAGTGATGGTGG - Intronic
1088109477 11:106245788-106245810 GAGCAGAAGCAAAATGGGGGAGG - Intergenic
1088190823 11:107226400-107226422 GGGGAGAAGAATACTGAGGGGGG - Intergenic
1088578640 11:111296883-111296905 GAGGGGAAGGACAATGGGGGTGG - Intergenic
1088613380 11:111600835-111600857 GGGGAGAAGTGAAATGACGGTGG - Intergenic
1088741787 11:112773560-112773582 GAGGAGAGGAGAGATGAGGCTGG + Intergenic
1088943460 11:114484403-114484425 GAGGAGAAAGAAAAAGAGAGAGG - Intergenic
1088952352 11:114584628-114584650 GAAGAGGAGAAAAATGAAGGAGG + Intronic
1088969034 11:114755137-114755159 GAGGAGCAGAAAAATGGGGTTGG + Intergenic
1089369621 11:117946136-117946158 CACAAGAATAAAAATGAGGGTGG + Intergenic
1089576469 11:119447864-119447886 GAGGAGCAGAGAAAGGTGGGTGG - Intergenic
1089593768 11:119561554-119561576 GAGGGGAAGGAAAAAGAGGAAGG - Intergenic
1089652009 11:119920613-119920635 CAGGAGAAGAGGAATTAGGGTGG + Intergenic
1090168717 11:124579373-124579395 GAGGAGGAGGAAGAAGAGGGAGG + Intergenic
1090402428 11:126457821-126457843 GAGGAAAAGAGATATGAAGGAGG + Intronic
1090549701 11:127806458-127806480 GAGGGAAGGAAAAAGGAGGGAGG - Intergenic
1090685966 11:129119901-129119923 GAAGAGAAGAAAGATGAGGTCGG + Intronic
1090725675 11:129525183-129525205 GAGGAGAAAAGAAAAGTGGGCGG + Intergenic
1090747781 11:129721058-129721080 GGGGAGAGGAAAAATGAGAGGGG - Intergenic
1090863285 11:130673256-130673278 CAGCAGAAGAGAAATGATGGTGG + Intronic
1091337127 11:134780632-134780654 GAGGAGGACAAAAAAGAGTGAGG - Intergenic
1091515780 12:1179801-1179823 GATATGAAGAAAAATGAGGCCGG - Intronic
1091673573 12:2470401-2470423 GTTGGAAAGAAAAATGAGGGGGG + Intronic
1091879255 12:3963468-3963490 GAGGAGAGGAAAAGTGAGTAGGG + Intergenic
1092236511 12:6814115-6814137 GAGCAGAAGACATATGGGGGGGG - Intronic
1092444421 12:8540846-8540868 GAGGAGAAAGAAAGAGAGGGAGG - Exonic
1092518253 12:9238518-9238540 GAGATGAAGGAAATTGAGGGAGG + Intergenic
1092601805 12:10074593-10074615 GAGAATAAGAAAAATTAGGAGGG + Intronic
1092674152 12:10897698-10897720 GAGGAAGAGAAAGATGGGGGAGG + Intronic
1093311805 12:17597495-17597517 GAAGAGAAGAAAAAAGAAAGAGG + Intergenic
1093318427 12:17680738-17680760 GAGGAGAAGAAAATTTGAGGAGG - Intergenic
1093364823 12:18280928-18280950 TAGAAGAAGAAAGATGAGGAAGG + Intronic
1093754947 12:22842099-22842121 GAGGAGAAGAAAGGAGAAGGAGG - Intergenic
1093760767 12:22906850-22906872 GAGGAGGAGAAATAAGAGGAGGG + Intergenic
1093772549 12:23034458-23034480 GGGAAGAAGAAAAAAGAGGGAGG - Intergenic
1093772586 12:23034865-23034887 GAGGAAAGGAAGAAGGAGGGAGG - Intergenic
1093795126 12:23301975-23301997 GAGGAAAAGAATGAAGAGGGAGG - Intergenic
1094003455 12:25721792-25721814 CAGGGGAAGGGAAATGAGGGTGG + Intergenic
1094026197 12:25961791-25961813 GATGAGATGAAAAATGGAGGGGG - Intronic
1094197026 12:27760283-27760305 GAAAAGAAAAAAAATTAGGGGGG - Intergenic
1094234382 12:28146846-28146868 GAGGAGAAGAAGAAAGAAGGAGG - Intronic
1094234390 12:28146896-28146918 GAGGAGGAGGAAGAGGAGGGGGG - Intronic
1094404002 12:30094945-30094967 CAGGAGAAGAAGAAGGAGCGGGG - Intergenic
1094469027 12:30785580-30785602 AAGGAGAAAAAAAAAGAGGCTGG + Intergenic
1094582460 12:31746651-31746673 GATGAGGAGAAAAAAGAGGCAGG + Intergenic
1095205007 12:39429849-39429871 GAGGAGAAAAAAGAAGAGGAGGG + Intronic
1095272608 12:40237517-40237539 AATGAGAAGAGAAAGGAGGGTGG + Intronic
1095407213 12:41880164-41880186 GAGGAGCAGAAAAGAGAGGGAGG + Intergenic
1095578190 12:43763699-43763721 GAGGGGAGGGAAAATGGGGGTGG - Intronic
1095654101 12:44649174-44649196 GAGAAGGAGAAAAATAAGGAAGG - Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096152841 12:49325467-49325489 GAGGAGAAGGAAAAGGAAGGGGG - Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096886141 12:54721273-54721295 GAGGAGAAGAAAAAGAAGAGAGG - Intergenic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097361910 12:58667559-58667581 GAGGAGAGAAAAAAAGAGGGTGG - Intronic
1097616642 12:61891685-61891707 GAGGAGGAGAAGGAGGAGGGAGG + Intronic
1097860282 12:64512035-64512057 GGGAAGAAGAGAAAGGAGGGGGG + Intergenic
1098236146 12:68420201-68420223 GAGGAGAGGAGGAAGGAGGGAGG + Intergenic
1098237899 12:68435625-68435647 GAGAAGAAGAAGTAAGAGGGAGG + Intergenic
1098445633 12:70563119-70563141 GAGGAGCAAGAGAATGAGGGAGG + Intronic
1098528711 12:71516110-71516132 GAGGAAAAGGAGAATGAGGGAGG + Intronic
1098603188 12:72358288-72358310 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1098754170 12:74337142-74337164 GTGGAGAAGGAAAATGTGGTAGG + Intergenic
1098830384 12:75354153-75354175 GAAGAGAAAAAAAAGGGGGGGGG + Intronic
1099442418 12:82714640-82714662 GAAGCGAAGGAAAATGAGGGAGG - Intronic
1099579347 12:84423106-84423128 GAGGAGAGAAAAAATAAGTGTGG + Intergenic
1099767671 12:87009423-87009445 GAGGAGGAGAAAAAAGATGGGGG + Intergenic
1099811501 12:87588070-87588092 GAGGAGGAGAAAAAGGAAGGAGG + Intergenic
1099997983 12:89800065-89800087 GCTGATAAGAAAAATGAGGCAGG - Intergenic
1100153613 12:91771622-91771644 GAGGAAATGAAAGATAAGGGTGG + Intergenic
1100535307 12:95503396-95503418 GAGAACAAGAAAAATGAGTATGG + Intronic
1100596671 12:96078087-96078109 GGGGGGAAAAAAAAAGAGGGGGG + Intergenic
1100673572 12:96842745-96842767 GAGAAGAGGAAAAAGGAGGAAGG - Intronic
1100915610 12:99417487-99417509 AAAGAGAAGAAAAAAGTGGGAGG - Intronic
1101084893 12:101225921-101225943 GAGGAGGAGAATGATGAGGAGGG - Intergenic
1101555718 12:105807243-105807265 CATGAGAAGGACAATGAGGGAGG - Intergenic
1101610016 12:106282806-106282828 TAGGAGGAGAAAATTGAGGCTGG - Intronic
1101915221 12:108890622-108890644 GAGAAGAAAAAAAAAGAGAGAGG - Intronic
1102194729 12:111016928-111016950 GAGAAGAAGAGAAGGGAGGGAGG - Intergenic
1102536761 12:113587697-113587719 AAGGAGAAGGAAAAGGAGTGGGG - Intergenic
1102591525 12:113959878-113959900 GAGAAGAAGAAAAAGGTGGCAGG - Exonic
1102704687 12:114870784-114870806 GAGGAGAGGAACAAAGAGAGTGG - Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102719130 12:115001473-115001495 GAGGAGAAGAAAGCCGAAGGGGG + Intergenic
1102974977 12:117200187-117200209 GAGAAGAAGAAAGAAGAAGGAGG - Intergenic
1103044841 12:117727462-117727484 GAGGAGGAGAAAGAAGAAGGAGG + Intronic
1103163230 12:118748459-118748481 GAGGAGGAGAAGAAAGAGGAGGG + Intergenic
1103263332 12:119608465-119608487 AATGAGAAGGAAAATGAAGGAGG + Intronic
1103317280 12:120066338-120066360 GAGGAGAAGGAAAATAAGTATGG + Intronic
1103410858 12:120710547-120710569 GAGGAGAAGAAGAAGGCGGGCGG + Exonic
1103658477 12:122494184-122494206 CAGGAAAAGAAATATGAGGCAGG - Intronic
1104488475 12:129172919-129172941 GAGGAGAGGGAAAATGATGGGGG + Intronic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1104814568 12:131638309-131638331 GGTGAGAAGAGAGATGAGGGTGG + Intergenic
1105544860 13:21343979-21344001 GAGGAGAAGAAGGAGAAGGGAGG - Intergenic
1105782053 13:23714352-23714374 CAGGAGAAGAAAAAAGAGGTTGG - Intergenic
1106293409 13:28387716-28387738 GAGGTGAAGATAACGGAGGGGGG - Intronic
1106525750 13:30539856-30539878 GAGGAAAAGAAAAAGAAGGACGG - Intronic
1106695979 13:32172810-32172832 GGGGAAAACAAAAATGAAGGTGG + Intronic
1106849594 13:33775299-33775321 GGGAAGAAAAAAAAGGAGGGGGG - Intergenic
1106849597 13:33775302-33775324 GAGGGGAAGAAAAAAAAGGAGGG - Intergenic
1107069086 13:36250455-36250477 GCAGAGAAGAAAAATGGGTGTGG + Intronic
1107182673 13:37479919-37479941 GATGAGAAAAGAAATGAGGGAGG + Intergenic
1107328559 13:39272020-39272042 GTTGATAAGAAAAATGAGAGGGG + Intergenic
1107329053 13:39277866-39277888 GGGGAGAAGGAAAGGGAGGGTGG - Intergenic
1107486086 13:40828799-40828821 CAAGAAAAGAAAAAGGAGGGTGG + Intergenic
1107658735 13:42617421-42617443 GAGGAGAGGAAAGAGGAGTGAGG + Intergenic
1107878013 13:44807397-44807419 AAGGAGAAGAAAATGGCGGGGGG + Intergenic
1108097343 13:46917358-46917380 TGGGGGAAGAAAAAGGAGGGAGG - Intergenic
1108233243 13:48372162-48372184 GAAGCGAAGAAAGCTGAGGGAGG + Intronic
1108717062 13:53091566-53091588 GAGGAGAAGCAAAGTGGGGAGGG + Intergenic
1108744962 13:53384022-53384044 GAGGAGGAGAAAGATGGAGGAGG - Intergenic
1108744971 13:53384108-53384130 GAGGAGGAGAAAGATGCAGGAGG - Intergenic
1108790273 13:53961529-53961551 GAGGAGAAGGGAAGGGAGGGAGG - Intergenic
1108879912 13:55099805-55099827 GAAGAGAAGAAAAATGTTGGAGG + Intergenic
1109106201 13:58253544-58253566 GCAAAGAAGAAAAATGAGGAGGG - Intergenic
1109132084 13:58599968-58599990 AAAGAGAAGAAACATGAGGATGG - Intergenic
1109507871 13:63330858-63330880 GATAAGAAAAAAAATGAGGTAGG - Intergenic
1109558706 13:64018013-64018035 GAGAATAAGAAAACTGTGGGTGG - Intergenic
1109677636 13:65700136-65700158 GAGGAGAAGTAAATGGAGTGTGG - Intergenic
1109757119 13:66775529-66775551 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1109863417 13:68229444-68229466 GAGGAGAGGACAAAAGAGAGAGG + Intergenic
1110423962 13:75344293-75344315 GAGGAAAAGAAAAATAAAGAAGG + Intronic
1110465551 13:75796812-75796834 AAGGAGAAGAAAAAGAAGAGAGG - Intronic
1110666159 13:78119493-78119515 GAGGAGGAGGACAAGGAGGGAGG - Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1111536537 13:89608759-89608781 GAGCAGTAGACAAATGAAGGAGG + Intergenic
1111670291 13:91321223-91321245 GAAGAGAAAAGAAAGGAGGGAGG + Intergenic
1111705867 13:91748823-91748845 GAGGAGAAGACAATTCTGGGTGG + Intronic
1112492234 13:99877379-99877401 CAGGGCAAGGAAAATGAGGGTGG - Intronic
1112839128 13:103553724-103553746 GAGGAGGAGAAAGAAGAGGAGGG - Intergenic
1112891536 13:104239424-104239446 GGGGAGGAGAAAAAAGAAGGTGG - Intergenic
1113259763 13:108548563-108548585 GAGGAGGATAATAATGATGGTGG + Intergenic
1113368946 13:109705386-109705408 AAGGAGAGGAAAAATGGGAGGGG + Intergenic
1113900203 13:113792625-113792647 GAGGAACAGACAGATGAGGGAGG - Intronic
1113975549 13:114225387-114225409 GAGGGGAGGAGAAGTGAGGGGGG + Intergenic
1114133820 14:19823843-19823865 GAGAAAAAGAAAAATAAGGAAGG + Intronic
1114393422 14:22334785-22334807 CAGGAAAGGAGAAATGAGGGAGG + Intergenic
1114490752 14:23100259-23100281 AAGAAGAAGAAAAAGGTGGGGGG + Exonic
1114491103 14:23102515-23102537 GAGGAGAGGAAAACTTAGGAAGG + Intergenic
1114524160 14:23357711-23357733 AAGGAGAAAAGAAGTGAGGGAGG - Intronic
1114552998 14:23544865-23544887 GAGGAGCAGAAAAAAAAGGTGGG - Intronic
1114557314 14:23569557-23569579 GAGGAGAAGAGAAAAAAGGCAGG + Exonic
1114559229 14:23578633-23578655 GAAGAGAAGAGAGAAGAGGGTGG + Exonic
1114987551 14:28250049-28250071 CAGCAAAAGAAAAATGAGGAAGG + Intergenic
1114999956 14:28410125-28410147 GAAGAGAAGGAAAAAGAAGGAGG + Intergenic
1115003136 14:28444957-28444979 GAGGAAAATAAATATTAGGGCGG + Intergenic
1115113207 14:29849216-29849238 GAGGAAAAGAAAGAGGAGGGAGG - Intronic
1115314310 14:32010079-32010101 GTGGAGGAGGAAAATGTGGGTGG + Intronic
1115440575 14:33430245-33430267 GAGGAAAAGAAGAATGGGGGAGG - Intronic
1115546018 14:34465374-34465396 GAGGATAAGCAAAATAAGGAAGG + Intergenic
1115815570 14:37160960-37160982 GAGGAGGAGAAAGAGGAAGGGGG + Intronic
1116008471 14:39323194-39323216 TAAGTGAAGCAAAATGAGGGTGG - Intronic
1116019846 14:39447094-39447116 AAGGAGAAAAAAAATTAAGGAGG + Intergenic
1116207105 14:41882524-41882546 GACGAGAAAAAAATTGAGGAAGG - Intronic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116255844 14:42554261-42554283 GAGAAGAAGAAAGAGGAAGGAGG + Intergenic
1116551956 14:46251574-46251596 TAGGAGCAGACAAGTGAGGGAGG - Intergenic
1116736989 14:48703833-48703855 GAGGAGCAGACAAATTATGGAGG - Intergenic
1116745595 14:48814566-48814588 GAGGAGAAGCCAAATAAGAGTGG + Intergenic
1116788943 14:49318910-49318932 GAGGAGAAGGGAAGGGAGGGAGG + Intergenic
1116827150 14:49683701-49683723 AAGGAAAGGAAAAATGAGGCAGG + Intronic
1117334132 14:54742327-54742349 GAGGAGAAATAGAATGGGGGGGG + Intronic
1117561602 14:56945847-56945869 GAGGGAAAGAAGAATGAGAGGGG + Intergenic
1117953861 14:61107900-61107922 GAGCAGAGGAAAAGTGAGGCCGG + Intergenic
1117978701 14:61321695-61321717 GAGGAGAAGCAAGAGGAGGCGGG + Exonic
1118017187 14:61672271-61672293 AAGGAGAAAAAAAGTGGGGGGGG + Intergenic
1118500923 14:66361958-66361980 GAGGAGAGGCAAAATGGTGGTGG + Intergenic
1118555971 14:67022312-67022334 GAGGAAAAGAAAAGAGAGAGAGG - Intronic
1118582705 14:67319272-67319294 CAGGAGAAGTAATATGAGTGAGG + Intronic
1118638460 14:67769745-67769767 CAGGAGGAGAAGAAAGAGGGAGG + Intronic
1118789089 14:69072651-69072673 GAAAAGAAAAAAAATGTGGGTGG + Intronic
1118840265 14:69504617-69504639 TAGAAGAAGAAAAATGAGGGTGG - Intronic
1118903445 14:70005443-70005465 CAGGAGAGGAAAAAAGAGGTTGG - Intronic
1118908408 14:70040803-70040825 GAGGAGAAGGGAACTGTGGGAGG + Intergenic
1119505272 14:75167405-75167427 GAGGAGGAGAAAAGAGAGAGAGG - Intronic
1119640176 14:76308871-76308893 GAGGAGAAAGAAAATCATGGAGG + Intergenic
1119707515 14:76793444-76793466 GAGGAGAAGGAAGAAGAGGGAGG + Intronic
1120128283 14:80773043-80773065 GGAGAAAAGTAAAATGAGGGTGG + Intronic
1120193981 14:81463372-81463394 GAGGAGAAGGACAATTAGGAGGG - Intergenic
1120346447 14:83296535-83296557 GAAGAGAAGAGAAGAGAGGGAGG + Intergenic
1120409053 14:84128281-84128303 AATGAGAAGAAAAATAATGGGGG + Intergenic
1120815675 14:88855274-88855296 AAGGAGATGAAAAATGAAGAAGG - Intronic
1120880811 14:89413979-89414001 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1121006379 14:90493207-90493229 GAGGAGGAGGAAAAAGAGGAGGG - Intergenic
1121038618 14:90727049-90727071 AAGGAGAAGAAAAAGAGGGGTGG + Intronic
1121043049 14:90765940-90765962 GAGAAAGAGAAAAATGAGGCTGG - Intronic
1121252697 14:92511686-92511708 GAGGAGAGGAAAAGTCAGTGGGG + Intergenic
1121310469 14:92932807-92932829 GAGGAGAAGAAAGAGGAGGAGGG + Exonic
1121976942 14:98413602-98413624 GTGGAAAAGACAAATGAGGGGGG + Intergenic
1122047493 14:99034435-99034457 GAGGGGGAGGAAAAGGAGGGAGG + Intergenic
1122322219 14:100861967-100861989 GAGGAGGAGGAAGAGGAGGGAGG - Intergenic
1122748819 14:103918053-103918075 GAGGACAGGAAATTTGAGGGCGG - Intronic
1122842197 14:104471404-104471426 GAGGAGCAGAAAAGTGGGTGAGG + Intergenic
1122846553 14:104503217-104503239 GAGAAGAAGCAAGATGGGGGAGG - Intronic
1122964455 14:105115509-105115531 GAGGAGAAGAAAACTGCGTATGG + Intergenic
1123453303 15:20388254-20388276 TAGTATAAGAAAAATGAGGGTGG + Intergenic
1123539257 15:21271709-21271731 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1123576891 15:21679430-21679452 GAGAAAAAGAAAAATAAGGAAGG + Intergenic
1123613513 15:22121898-22121920 GAGAAAAAGAAAAATAAGGAAGG + Intergenic
1123775400 15:23574529-23574551 CAGGAGAGGAAATCTGAGGGGGG + Intronic
1124459635 15:29877620-29877642 GAGAAGAAGAAAGAAGAAGGAGG - Intronic
1124493003 15:30169640-30169662 AAGGAGAAAACAAACGAGGGGGG + Intergenic
1124750531 15:32368685-32368707 AAGGAGAAAACAAATGAGGGGGG - Intergenic
1124816731 15:33001538-33001560 GAGGAGGAGGAGGATGAGGGGGG - Intronic
1124957776 15:34370922-34370944 GAGGAGAAGGGAAGTGAGGAAGG - Intergenic
1124957802 15:34371016-34371038 GAGGAGGAGAGAAAGGAGAGAGG - Intergenic
1125142135 15:36420712-36420734 GAGGTGAAGAGAAATCAGTGTGG - Intergenic
1125311670 15:38385897-38385919 GAGGAGATGGAAGGTGAGGGAGG - Intergenic
1125344717 15:38707481-38707503 GTGGAAAAGTGAAATGAGGGAGG - Intergenic
1126052314 15:44697180-44697202 GAGGAGAAGAAAAAGAAAGGAGG - Intronic
1126173373 15:45713050-45713072 GAGGAGAGAAAAAAGAAGGGAGG - Intergenic
1126218051 15:46179797-46179819 GAGAAGACCAAAAATGAGTGGGG - Intergenic
1126390459 15:48144169-48144191 GAGGAGAAAAAAAAGGAGAAAGG + Intronic
1126399711 15:48256826-48256848 GAGGACAAGAAATTTGGGGGGGG - Intronic
1126551890 15:49940590-49940612 TAGACAAAGAAAAATGAGGGTGG + Intronic
1126944017 15:53797843-53797865 GAGGAGAAGAAAGAGAGGGGAGG + Intergenic
1126966833 15:54063544-54063566 TAGGAGAATAAAAATGAGTGAGG - Intronic
1127071860 15:55295201-55295223 AAGGAGAAGGAAAGGGAGGGAGG + Intronic
1127102966 15:55586824-55586846 GAGGAGAGGAAATATGTGTGGGG - Intronic
1127122065 15:55780375-55780397 GAGGAGGAGAAGAAAGAAGGTGG + Intergenic
1127122066 15:55780378-55780400 GAGGAGAAGAAAGAAGGTGGAGG + Intergenic
1127150569 15:56070676-56070698 AAGGAGAAGAACAAAGATGGAGG + Intergenic
1127392957 15:58521665-58521687 GAGGGGAAGAAAGAGGAAGGGGG + Intronic
1127582339 15:60349830-60349852 GAGGGGAAGGAAAGGGAGGGAGG + Intronic
1127946801 15:63763523-63763545 AAGGAAAAGAAAAATGGAGGAGG + Intronic
1128095659 15:64952737-64952759 GAGGAGAAGAGGAAAGAAGGAGG - Intronic
1128240947 15:66100535-66100557 CAGGTGAAAAAAACTGAGGGAGG - Intronic
1128264361 15:66253897-66253919 AAAGAGGAAAAAAATGAGGGGGG - Intergenic
1128370532 15:67036004-67036026 GAGGAGAAGGGAAGTGAGGTGGG - Intergenic
1128697828 15:69781635-69781657 GAGAAGAAGAAAACTGACTGGGG + Intergenic
1128896415 15:71377599-71377621 GAGGATAAGGAGAAAGAGGGCGG + Intronic
1129077836 15:73012639-73012661 GAGGAGAAGGGAGGTGAGGGAGG - Intergenic
1129199312 15:73989328-73989350 GAGGAGGAGAGAAGTGAGGAAGG - Intronic
1129602915 15:77010625-77010647 AAAGAGAAGAAAAGTGAGAGAGG - Intronic
1129723278 15:77889303-77889325 GAGGTGAAAAGAAAGGAGGGAGG - Intergenic
1130091597 15:80825646-80825668 GAGGAGAACAAAAGTGAGAGAGG + Intronic
1130123195 15:81069964-81069986 CAGGAGGACAAGAATGAGGGCGG + Intronic
1130225994 15:82058820-82058842 GAGGAGAGGGAAGAGGAGGGAGG - Intergenic
1130236302 15:82137545-82137567 GGGGTGAAGAAAACTCAGGGAGG + Intronic
1130363279 15:83209516-83209538 GAAGAGGAGAGAAATGAGAGGGG + Intergenic
1131014148 15:89043496-89043518 GAGGAAAAGAAAGAGGAAGGAGG + Intergenic
1131059487 15:89395859-89395881 GAGGGGGAGAAAGAGGAGGGGGG - Intergenic
1131124145 15:89843980-89844002 GAAGAGGGGAAAAAGGAGGGAGG + Intronic
1131309658 15:91278279-91278301 GAGGAGAAGAAAATTGTTTGAGG + Intronic
1131418712 15:92284996-92285018 AAGTAGAAGAAAACTGAAGGAGG - Intergenic
1131580397 15:93637248-93637270 GAGGAGGAGAAAAAAGAAGAGGG - Intergenic
1131620780 15:94065899-94065921 GAGGAAAAAAAAAAGGTGGGGGG + Intergenic
1131625957 15:94120934-94120956 GAGGAGAAGGAAGAAGAGGAGGG - Intergenic
1131683143 15:94744895-94744917 AAGGAGAAGGGAAAGGAGGGAGG + Intergenic
1131780152 15:95847206-95847228 GAGAAAAAGAAAAACAAGGGAGG - Intergenic
1131810320 15:96166633-96166655 GAGGAGAAGAAATAGGGGCGGGG - Intergenic
1132083290 15:98885393-98885415 GAGGAGAAGGAAAGGGAGAGGGG - Intronic
1132431651 15:101766182-101766204 AAGGAGAGGAAGAAGGAGGGAGG - Intergenic
1202985759 15_KI270727v1_random:413675-413697 GAGAAAAAGAAAAATAAGGAAGG + Intergenic
1133326527 16:4945396-4945418 GAGAAGAAGAAAAAGGAATGTGG - Intronic
1133460684 16:5983983-5984005 GAGAAGAAGAAGAATGTGGGAGG - Intergenic
1133578888 16:7123900-7123922 GTGGAGAAGAGAAAGGAGAGAGG + Intronic
1134012144 16:10862401-10862423 GAGGAGAAAAAAAATTATGCAGG + Intergenic
1134111031 16:11515754-11515776 GAGGAGGAGAAAAAGGGAGGAGG + Intronic
1134197791 16:12172259-12172281 GATGGGAAGAAAAAGAAGGGAGG + Intronic
1134324287 16:13192883-13192905 GAGAAGAAGAAGAAAGAAGGAGG + Intronic
1134569379 16:15278455-15278477 GAGAAGAGGAAAATGGAGGGTGG - Intergenic
1134610268 16:15602637-15602659 GAGGAGAAAGAAAAGGAGGAGGG + Intronic
1134732998 16:16477590-16477612 GAGAAGAGGAAAAGGGAGGGTGG + Intergenic
1134892584 16:17854062-17854084 AAGGAGATGGAAGATGAGGGAGG + Intergenic
1134934440 16:18234383-18234405 GAGAAGAGGAAAATGGAGGGTGG - Intergenic
1135469906 16:22721155-22721177 GAAGAGAAAAAAAATGTGGCCGG - Intergenic
1135703736 16:24656164-24656186 AAAGAAAAGAAAAATGAGGCCGG + Intergenic
1135724757 16:24845925-24845947 GAGGGGAGGAAAAATGCTGGCGG - Exonic
1135983745 16:27168562-27168584 TAGGGGAAGAAAGATGAAGGAGG + Intergenic
1136107386 16:28039957-28039979 GAGATGGAGAAAAACGAGGGAGG - Intronic
1136157345 16:28392020-28392042 GAGGAGGAGGACAATGAAGGCGG - Exonic
1136205741 16:28723261-28723283 GAGGAGGAGGACAATGAAGGCGG + Exonic
1136491885 16:30613939-30613961 AAGGAGAAGAAAGAAGAAGGAGG + Intronic
1136574398 16:31114916-31114938 AAGAAAAAGAAAAAAGAGGGAGG - Intergenic
1137543679 16:49382810-49382832 GTGGAGAAGGAAGACGAGGGAGG - Intronic
1137820391 16:51439125-51439147 GAGAAAAAGAAAAAAGAGGGAGG + Intergenic
1137964938 16:52921505-52921527 GAGGGAAAGAAAATTGAGGTGGG - Intergenic
1137972712 16:53001570-53001592 GAGGGGAAGAAATATGGGAGGGG + Intergenic
1138055346 16:53827215-53827237 TAGAAGAAGAGAAATGTGGGTGG - Intronic
1138126173 16:54440500-54440522 GAGGAGGAGAAGGAGGAGGGAGG - Intergenic
1138141046 16:54568792-54568814 GAGGAGAAGAAAAACAGGAGGGG + Intergenic
1138173548 16:54875568-54875590 GAGGAGAGGAAACATGGGAGAGG - Intergenic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138316336 16:56073319-56073341 GAGGAGAAGGAAAAAGGGAGAGG - Intergenic
1138540494 16:57684666-57684688 GAGGGGAAGTGAAATGAGAGAGG + Intronic
1139001183 16:62512001-62512023 GAGAGGAAGAAAAGTGGGGGGGG + Intergenic
1139144777 16:64310087-64310109 GGGGTGAAGAAAAGTGAGGAGGG + Intergenic
1139165570 16:64561397-64561419 AAGGAGAAGAAGAAAGAAGGAGG + Intergenic
1139169364 16:64612515-64612537 GAAGAGAGAAAAAATGAAGGTGG - Intergenic
1139413922 16:66790302-66790324 GAGGAGAAGGGAAAGGAGGGAGG + Intronic
1140657040 16:77151687-77151709 AAGGAGAGGAAAAATGAGAATGG - Intergenic
1140681560 16:77390297-77390319 GTGGAGAAGAAAATTTAAGGAGG + Intronic
1140712385 16:77690645-77690667 GAGGTGACGGAACATGAGGGCGG - Intergenic
1140740335 16:77936042-77936064 GGGGAGAAAAAAAAGGAGGTGGG + Intronic
1140944456 16:79754906-79754928 GAGAAAAAGAAAATTCAGGGAGG + Intergenic
1141275546 16:82584648-82584670 GAGAAGAAGAAGAAGTAGGGAGG + Intergenic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1141713983 16:85716520-85716542 GGGGAGAAGGAAGAGGAGGGAGG + Intronic
1141845216 16:86603866-86603888 GAGGAGAAGAAAGAGGAGTGAGG - Intergenic
1141931886 16:87210740-87210762 GAGGAGAAAGAAAAAGAGAGAGG + Intronic
1142251482 16:88993875-88993897 AAGGAGAAAAAAAGGGAGGGAGG - Intergenic
1203142019 16_KI270728v1_random:1772884-1772906 TAGGATAAGAAATATGAGGACGG - Intergenic
1142484580 17:238221-238243 AAGGAGAAAAGAAAAGAGGGAGG + Intronic
1142714260 17:1739332-1739354 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714281 17:1739422-1739444 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714331 17:1739645-1739667 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714395 17:1739915-1739937 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714438 17:1740095-1740117 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714522 17:1740455-1740477 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714791 17:1741580-1741602 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714811 17:1741670-1741692 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714834 17:1741760-1741782 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714887 17:1741983-1742005 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714899 17:1742028-1742050 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142832316 17:2558363-2558385 GAAGAGAAGAAAGACCAGGGTGG + Intergenic
1143216625 17:5229912-5229934 GAGGAGAGGAGAAAGGAGAGAGG - Intronic
1143270030 17:5668597-5668619 GAGGAGAAGTAAGAGGAGGAGGG - Intergenic
1143270041 17:5668653-5668675 GAAGAGAAGAAAGAGGAGGAAGG - Intergenic
1143435736 17:6923352-6923374 CAGGAGAAGCAAACTGGGGGAGG + Intronic
1143800099 17:9372216-9372238 TAGGAGAAGAAAAAGACGGGAGG - Intronic
1143891335 17:10104780-10104802 GTGGAGAAGGAAAATGTGGATGG - Intronic
1144378253 17:14667136-14667158 GGGGAGAAGAGAAAAGAGGTAGG + Intergenic
1144457432 17:15430607-15430629 GAGAAGAAGGGAAAGGAGGGAGG + Intergenic
1144640729 17:16935197-16935219 GGGGAGCAGAGAATTGAGGGTGG + Intronic
1144684294 17:17215953-17215975 GAGGTGAAGAAAAAGGCTGGAGG + Intronic
1144734529 17:17547643-17547665 GAGGAGGAGGAAGAGGAGGGAGG - Intronic
1145102975 17:20092066-20092088 AAGTAGAAGAGAAAGGAGGGAGG - Intronic
1145940702 17:28742010-28742032 GAGGAGAAGCAATATCAGGGTGG - Exonic
1146125826 17:30230669-30230691 GTGGAGAAGAGAAAAGAGAGGGG + Intronic
1146339700 17:32007961-32007983 GAGGAGGAGTAAGAGGAGGGGGG + Intronic
1146948408 17:36889750-36889772 CAGGAGGAGGAAGATGAGGGTGG + Intergenic
1147129738 17:38400047-38400069 GAGCAGGAGAGAAAGGAGGGTGG + Exonic
1147305709 17:39562835-39562857 AAGGAGGAAAAAAATGAGAGAGG - Intronic
1147498817 17:40942570-40942592 GAGGAGGAGGAAGATGAAGGAGG - Intergenic
1147839414 17:43360392-43360414 GAGGGCTAGAAAAATGAGGCCGG - Intergenic
1149114165 17:53071729-53071751 GAGAAGAAGAAAAAGGAGGGAGG + Intergenic
1149367312 17:55958851-55958873 GGGGAGGAGAAAAGTAAGGGAGG + Intergenic
1149375846 17:56043073-56043095 GAGATGAAGAAACCTGAGGGAGG + Intergenic
1149586426 17:57790744-57790766 GTGGAGAAGAAGAAAGTGGGTGG - Intergenic
1149690492 17:58571583-58571605 GAGGAAAAGAAAAAAAAAGGAGG + Intronic
1149821329 17:59780882-59780904 GAAGAAAAGAAAAATCAGGCTGG - Intronic
1149911937 17:60574674-60574696 GGGGAGAAGAAAAAAGATGATGG - Intronic
1149982607 17:61323274-61323296 GAGGAGAAGAATAATCAGAACGG - Intronic
1150273747 17:63882800-63882822 GAGGAGGAGACAAAAGAGGAGGG - Intergenic
1150278042 17:63912149-63912171 GAGGAGGAGAAAAAAGAGGACGG - Intronic
1150279357 17:63920034-63920056 GAGGAGGAGAAAAAAGAGGAGGG - Intergenic
1150647244 17:66986557-66986579 GAGCAGAAGACATATGAGTGAGG + Intronic
1150931813 17:69592962-69592984 GAGAAGAAAAAAATGGAGGGAGG - Intergenic
1151371418 17:73648499-73648521 GTTTAGAAGAAAAATGAGTGAGG + Intergenic
1151383570 17:73741756-73741778 GAGAAAAAGAAAAAGGAGGCAGG - Intergenic
1151429317 17:74051726-74051748 GAGGAACAGGAAAATGAGGCTGG + Intergenic
1151439392 17:74118488-74118510 GAAGGGAAGAAAAAAGAGAGGGG - Intergenic
1152019478 17:77772915-77772937 GAGGAAAAGGGAAGTGAGGGGGG - Intergenic
1152084064 17:78206659-78206681 GAGGAGAAGAAAGAAGATGAAGG - Intronic
1152297027 17:79473797-79473819 GAGGAGGAGAAAAATGGAGGCGG - Intronic
1152328569 17:79657134-79657156 GAGGAGAAGAATGAGGAGGAAGG + Intergenic
1152652974 17:81504579-81504601 GAGGAGAGGAGAAAAGAGGGAGG + Intergenic
1152763863 17:82124807-82124829 AAAGAAAAAAAAAATGAGGGGGG + Intronic
1153049582 18:889025-889047 GAAGAGAAGACACTTGAGGGAGG + Intergenic
1153185247 18:2478892-2478914 GAGGAGGAGGAAGAAGAGGGAGG + Intergenic
1153245388 18:3068037-3068059 GGAGAGAAGTAAAATAAGGGTGG - Intronic
1153331306 18:3878460-3878482 GAGGAGGAGGAAAAGGAGGAAGG - Intronic
1153367639 18:4276008-4276030 GAGGAGCAGAAAAAAGAGAGAGG + Intronic
1153549131 18:6242386-6242408 GAGGAGAAGGATAATGGCGGTGG - Intronic
1153780108 18:8486965-8486987 GATGAGAAGAAGAAAGAGGCAGG - Intergenic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154136550 18:11785083-11785105 GAGGGGACGAAAACTGAGCGTGG - Intronic
1154434435 18:14333118-14333140 GTGGAGGTGAAAGATGAGGGTGG + Intergenic
1155053920 18:22169362-22169384 GGGGAGGAGAGAAAAGAGGGTGG - Intergenic
1155064725 18:22258397-22258419 GAGGAGGAGGAAAAGGAGGAAGG - Intergenic
1155242515 18:23877116-23877138 TTGGAGAAGACAGATGAGGGAGG + Intronic
1155512711 18:26593758-26593780 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155512724 18:26593816-26593838 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155540241 18:26862476-26862498 GAGGAGAACAAAAATAAGCATGG + Exonic
1155627728 18:27854049-27854071 GAAGATAAGAAAAATAAGTGGGG + Intergenic
1155646759 18:28087937-28087959 GGGGAGGAAAAAAATGAGGCGGG - Intronic
1155844307 18:30686355-30686377 GAGGAAAAGAAGAAAGAGGAGGG + Intergenic
1156100542 18:33588970-33588992 GAGTAGAAGAAAAAAGATGAAGG - Intronic
1156173744 18:34517584-34517606 GAGGGGAAGAGAAATGAGCATGG - Intronic
1156368508 18:36451601-36451623 GAGGAGAAGGAAGAGGAGGGAGG - Intronic
1156390420 18:36645084-36645106 GAGGAAAAGAAGACTGAGGCTGG + Intronic
1156588422 18:38458964-38458986 GGGGAGAAAAAAAAAGAGAGTGG + Intergenic
1156694637 18:39752487-39752509 GAGGACAAGAACAATGAGCTGGG - Intergenic
1156730278 18:40185764-40185786 GAAAAGAAGAAGAATGAGGAGGG + Intergenic
1156952029 18:42912960-42912982 AAAAAGAAGAAAAACGAGGGAGG + Intronic
1157038603 18:44008939-44008961 GAGGAGAACAGGAATTAGGGAGG + Intergenic
1157129794 18:44996137-44996159 GAGAAGAAGAGAAAAGAGGGAGG - Intronic
1157308070 18:46531406-46531428 GATGAGGGGGAAAATGAGGGGGG - Intronic
1157408077 18:47440526-47440548 GAGAAGAAGGAGAGTGAGGGAGG + Intergenic
1157748437 18:50157567-50157589 GGGGAGAAGAGAAATGTGGCTGG - Intronic
1157763301 18:50280702-50280724 AAGGAGAAGAAAAATAAGGGGGG - Intronic
1158146962 18:54325155-54325177 CAGGATAAGGGAAATGAGGGAGG - Intronic
1158156818 18:54435276-54435298 GAGAAGCATAAAAATGAAGGAGG - Intergenic
1158195405 18:54879972-54879994 GAAGAGAAGAAATATGAGCTGGG - Intronic
1158213107 18:55071884-55071906 AAAGAGAAGAAATTTGAGGGTGG + Intergenic
1158313772 18:56188357-56188379 GGGTAGAAGAATAATGAGAGTGG + Intergenic
1158489199 18:57894827-57894849 GAGGAGAAGCCAAGTGAAGGTGG + Intergenic
1158746637 18:60207485-60207507 GATGAGAAGAGAAATAATGGTGG + Intergenic
1158975277 18:62705383-62705405 TAGGAGAAAAAAAATCTGGGAGG + Intergenic
1159115316 18:64106737-64106759 AAGGAGCAGAAAAATGACGCAGG + Intergenic
1159122747 18:64189945-64189967 AAGGAGAAAAATTATGAGGGGGG - Intergenic
1159318607 18:66814879-66814901 GAGGGTAAGGAAAATGAGGAAGG + Intergenic
1159746515 18:72242868-72242890 AGGGTGAAGAAAAATGGGGGTGG + Intergenic
1159816221 18:73077111-73077133 CAGGAGAAGACAAATAATGGAGG - Intergenic
1160340462 18:78084971-78084993 GAGGAAAATAAAAATGGGGTGGG + Intergenic
1160434491 18:78836072-78836094 AAGGAGAGGAAATATGGGGGAGG + Intergenic
1160971250 19:1768745-1768767 GAGGTGAAGAAAACAGAGGAAGG + Intronic
1161100528 19:2419001-2419023 GAGGGGAAGGAAAGGGAGGGAGG - Intronic
1161100569 19:2419107-2419129 GAAGAGAAGGAAAGGGAGGGAGG - Intronic
1161366943 19:3885583-3885605 GAGGAGAGGAGAAAGGAGAGAGG + Intronic
1161370536 19:3908650-3908672 GAGGAGAAGAAAGGGGAAGGGGG - Intronic
1161370579 19:3908766-3908788 GAGGAGAAGGAAGAGGGGGGAGG - Intronic
1161370580 19:3908769-3908791 GAGGAGGAGAAGGAAGAGGGGGG - Intronic
1161599719 19:5174248-5174270 GATGAGAAGATAAATGTGGGCGG + Intronic
1161842945 19:6693700-6693722 GAGGAGAAGGATATTGAGGGTGG + Intronic
1161847708 19:6721087-6721109 GAGGGGAAGTAGAATGGGGGAGG + Intronic
1161924023 19:7287944-7287966 GATGAGTAGACAAATGAGTGTGG + Intronic
1162304738 19:9865146-9865168 GAGGAGAAGAAGAAGAAGGGAGG - Intronic
1162555865 19:11385143-11385165 CAAGAGAATAAAAATGTGGGTGG - Intronic
1162864948 19:13538573-13538595 GAGGGGAAGAAAACTGGGGCGGG + Intronic
1162991757 19:14307416-14307438 GGGGAGAAGAAAAATGAGACAGG - Intergenic
1163457527 19:17416712-17416734 GAGGAAAAAAAAAAAAAGGGTGG - Intronic
1163538628 19:17893436-17893458 GAGAAGCAGAGAAAGGAGGGAGG + Intronic
1163641234 19:18463269-18463291 GAGGAGGAGCAACCTGAGGGGGG + Intronic
1163701666 19:18789513-18789535 GAGGGGAGGAAGGATGAGGGCGG + Intronic
1164250190 19:23469049-23469071 GAGAAGAAGGAAAAAGAGGATGG - Intergenic
1164250274 19:23469629-23469651 GAGGAGATGGAGAAGGAGGGGGG - Intergenic
1164265380 19:23610925-23610947 GAGAACAAGAAAAAGCAGGGTGG - Intronic
1164292145 19:23878569-23878591 GAGGAGAAGAAAATAGGAGGAGG + Intergenic
1164292595 19:23881237-23881259 GAGGAGAGGAAAAGTAAAGGAGG + Intergenic
1164441690 19:28284445-28284467 GAGGGGGAGGAAAAGGAGGGTGG + Intergenic
1164729128 19:30488751-30488773 GGGGAGAAGAAAGGGGAGGGAGG - Intronic
1164739224 19:30564350-30564372 GAGTAGAAGAGAAATGGTGGAGG + Intronic
1164868733 19:31625978-31626000 GGGGAGGAGAAAAGTGAAGGGGG - Intergenic
1164868767 19:31626111-31626133 GAGGAGGAGAGAAGTGAAGGGGG - Intergenic
1164943423 19:32269355-32269377 GAGAAAAAGAAAAATTAGGTAGG - Intergenic
1165566130 19:36729904-36729926 GAGGAGATGCAAAATCAGTGTGG + Intronic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165717382 19:38055242-38055264 CATGAGAAGAAAAGGGAGGGAGG + Intronic
1165723839 19:38099004-38099026 GAGAAGAAAAGAAAGGAGGGAGG - Intronic
1165775582 19:38402802-38402824 CAGCAGAAGACAACTGAGGGAGG + Intergenic
1165834256 19:38744593-38744615 ATGGAGAAGAAACATGAAGGCGG - Intronic
1165960307 19:39528689-39528711 GAAAAGAAGAGCAATGAGGGTGG + Intergenic
1166195623 19:41203808-41203830 AAGGAGAAGAAAGATGCAGGGGG - Intronic
1166256820 19:41612568-41612590 TAGCAGAATAAAATTGAGGGTGG + Intronic
1166335878 19:42106863-42106885 GAGGAGAAGGAAAATTAGCCAGG + Intronic
1166536664 19:43578933-43578955 AAAGAGAAGGAAAATGTGGGAGG + Intronic
1167520443 19:49951573-49951595 GAGGAGGAGAGATAGGAGGGAGG + Intronic
1167674493 19:50875945-50875967 GAGGAGGAGAGGCATGAGGGTGG - Intronic
1167726094 19:51213830-51213852 AAGAAAAAGAAAAATGAGGCTGG - Intergenic
1168058581 19:53877732-53877754 GAGGAGAATGAAAGTGAAGGAGG + Intergenic
1168103540 19:54153521-54153543 CAGGAGAAGGAAAATGAGACAGG - Intronic
925115553 2:1375484-1375506 GGGGAGAAGGAAAAAGAGGGAGG + Intronic
925402563 2:3586022-3586044 GAGGAGAGGAAAAAGGAGGAGGG + Intergenic
925562821 2:5216544-5216566 GAGGAGGAGAAAAAGGAAGAGGG - Intergenic
925571679 2:5318981-5319003 GATGGAAAGAAAGATGAGGGAGG + Intergenic
925628009 2:5861590-5861612 GTGTAGAAGAAAAATTTGGGGGG - Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925984389 2:9204307-9204329 AAGGCGAAGAAAAAGGAGGAAGG - Intergenic
926097411 2:10091208-10091230 AAGCAGAAGAAAAATGAGAAGGG + Intergenic
926340047 2:11897952-11897974 CAGGAGAAAAAAAATCAGTGAGG + Intergenic
926481996 2:13410978-13411000 TAGTATAAGAAAAATGAGGGTGG - Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926574462 2:14564708-14564730 AAGAAGAAGAAACAGGAGGGAGG + Intergenic
926770861 2:16373908-16373930 GAGGAGAAAAAAAGGGAGAGGGG - Intergenic
926771767 2:16384317-16384339 GATGAGCAGAAAAATGTGAGTGG + Intergenic
926871332 2:17421186-17421208 GAGGAGCAAATAAATGGGGGAGG - Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
927003226 2:18821478-18821500 GAGGAGAAGAAAGCTGATGGGGG + Intergenic
927279646 2:21293010-21293032 GAGGTGAAGAAAAATGAAAGTGG - Intergenic
927295876 2:21452668-21452690 GAGAAGAAAACAAATTAGGGAGG - Intergenic
927305006 2:21560895-21560917 GGGGTGAGGAAAAATGAGTGAGG - Intergenic
927409932 2:22813633-22813655 GAGAAACAGAACAATGAGGGGGG + Intergenic
927648586 2:24897234-24897256 GAGGAGGAGAAAAAGGAGAAGGG - Intronic
927808485 2:26168986-26169008 GAGGGGAGGAAAAAGTAGGGAGG - Intergenic
927946669 2:27138856-27138878 GAGGAGAGGAATAAGGAGGAAGG + Intronic
927960212 2:27236565-27236587 GATGGGAAGAAGAAAGAGGGAGG + Intronic
928062097 2:28124597-28124619 GTAGAGAATAAAAATTAGGGAGG + Intronic
928139414 2:28715497-28715519 GAGGATAAAAAAACTGAGGAAGG + Intergenic
928218197 2:29380073-29380095 GAGGAAAAGAGCAATGAGGAAGG + Intronic
928219501 2:29391703-29391725 AAGGAAAGGAAAAGTGAGGGAGG - Intronic
928223275 2:29423223-29423245 GAGGAGGAGAAACAAGGGGGAGG + Intronic
928373777 2:30759162-30759184 AAGGAGGAGAAAAACGAGGGAGG - Intronic
928660804 2:33500186-33500208 AAAGAGAGGAAAAAGGAGGGAGG + Intronic
928746728 2:34424752-34424774 GAGAAGGAGAGAAAGGAGGGGGG + Intergenic
928807615 2:35179693-35179715 GAGGAGTAGTAAAATAAGGTTGG - Intergenic
929015007 2:37485221-37485243 GAGGAGAAGGAATATGGAGGAGG - Intergenic
929016976 2:37507416-37507438 GAAGAGAAGATAAATGAAAGGGG - Intergenic
929046837 2:37798619-37798641 GAGGGGAAGAGAAAGAAGGGTGG - Intergenic
929879639 2:45824605-45824627 AAGGAGGAGAAAAAGAAGGGAGG - Intronic
930175274 2:48295056-48295078 GGAAAGAAGAAAAATGAAGGGGG - Intergenic
930207517 2:48602770-48602792 GAGTAGAAGAAAAAAGAGAATGG + Intronic
930225890 2:48792658-48792680 TAGGAGAAGAAAGATGATGATGG - Intergenic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930804698 2:55478815-55478837 GAGGAGATAAGAGATGAGGGAGG - Intergenic
930871632 2:56176893-56176915 GGTGAGCAGCAAAATGAGGGTGG - Intergenic
931052599 2:58430218-58430240 GAGCAGAATAGAAATGAGAGTGG + Intergenic
931415847 2:62079541-62079563 GAGGGCAAGGAAAATGAGGCTGG - Intronic
931894774 2:66716535-66716557 GAGGTGAAGAGAAGTGAGGGAGG - Intergenic
932018676 2:68060046-68060068 GAGAAGTAGAAAACTGTGGGAGG - Intronic
932143216 2:69297486-69297508 AAGGAGAAGGAAAATGTGTGTGG - Intergenic
932205285 2:69875405-69875427 GAAAAAAAGAAAAATGAAGGTGG - Intronic
932312824 2:70757680-70757702 CAGGACAGGAAAAGTGAGGGCGG - Intronic
932511476 2:72297345-72297367 GAGGAACAGGAAAATGAGGAGGG - Intronic
932570312 2:72935040-72935062 GAGGTGAAGAAGAAAGAGAGGGG - Intronic
933027064 2:77272772-77272794 GAGGAAGAAAAAAAGGAGGGTGG - Intronic
933199619 2:79434322-79434344 GAGAAGAAGAAAAATAAGAGAGG + Intronic
933248012 2:79997306-79997328 AAGGAGAAAAAAAGAGAGGGAGG + Intronic
933374665 2:81464257-81464279 GAGGTAATTAAAAATGAGGGTGG - Intergenic
933481374 2:82861217-82861239 GAGGAGGAGAAAAAGAAGGAAGG - Intergenic
933488659 2:82955954-82955976 GAGAAGAAGAAAGAGGAAGGAGG + Intergenic
933657972 2:84905152-84905174 AAGGAGAGGAAAAGTGGGGGAGG + Intronic
933792042 2:85890596-85890618 GAGGGCTAGAAAAATGAGGCTGG - Intergenic
933851453 2:86370017-86370039 GAGGAGAGAAGAAATGAAGGAGG + Intergenic
934037989 2:88104619-88104641 GGGGAGTGGAAAAATGATGGTGG - Intronic
934138478 2:89020610-89020632 GGGCAGAAGGGAAATGAGGGAGG - Intergenic
934144563 2:89078709-89078731 GAGCAGAAGGGAAATGAGGGAGG - Intergenic
934224689 2:90121840-90121862 GAGCAGAAGGGAAATGAGGGAGG + Intergenic
934230766 2:90179943-90179965 GGGCAGAAGGGAAATGAGGGAGG + Intergenic
934724841 2:96609343-96609365 AAAGAAAAGAAAAATGAGAGTGG - Intronic
935044608 2:99469125-99469147 GGGGAGAAGAAAAAAGTTGGGGG + Intronic
935051487 2:99528734-99528756 GAGGAGAAAGGAGATGAGGGAGG - Intergenic
935446431 2:103161445-103161467 GAGGAGAAGGAAAATATGGAGGG + Intergenic
935489523 2:103699017-103699039 AAGGATAAGAAAAATGGGGAAGG - Intergenic
935613097 2:105046603-105046625 GAGGAGGAGCAAGATCAGGGAGG - Intronic
935660221 2:105460464-105460486 ATGGAGAAGAAAAATGTAGGAGG + Intergenic
935848989 2:107198310-107198332 GAGGAGGAAGAAAAAGAGGGAGG + Intergenic
936122497 2:109758941-109758963 GAGGGGAAGAAAAAAGAGGAGGG + Intergenic
936222196 2:110612531-110612553 GAGGGGAAGAAAAAAGAGGAGGG - Intergenic
936379554 2:111972338-111972360 GAGGACATGAAACATGAGGATGG + Intronic
936741257 2:115512081-115512103 GAAGAGAAGAAAAGAAAGGGAGG - Intronic
937075748 2:119105143-119105165 GTGGAGAAGAACAATCAGGAGGG - Intergenic
937110778 2:119365954-119365976 GAAGAGTAGAAAGATGAGGCTGG - Intronic
937404619 2:121615382-121615404 CAGCATAAGTAAAATGAGGGAGG + Intronic
937520109 2:122703381-122703403 AAGGAGAAGAAAAAGAGGGGAGG + Intergenic
937563277 2:123251431-123251453 AAGGAGAAGAAGAAAGATGGCGG + Intergenic
937768795 2:125694848-125694870 GAAGAGAAGAAAGATGAGAGAGG + Intergenic
937794243 2:125998201-125998223 GGGGAGAGGTAAAAAGAGGGAGG + Intergenic
937988172 2:127647937-127647959 GAGGAGAGGTAAAAGGAGGGAGG - Intronic
937992357 2:127671733-127671755 AAGTAGAAGAAAAAGGAAGGAGG + Intronic
938621558 2:133059932-133059954 CAGAAAAAAAAAAATGAGGGAGG + Intronic
938622362 2:133069455-133069477 GAGGGAATGAAAAATGAGAGGGG - Intronic
938880960 2:135587906-135587928 GAGGGGGAGAAAAATGGGTGGGG - Intronic
939040576 2:137184416-137184438 GAGGAGATTGAAAATAAGGGAGG + Intronic
939053528 2:137334295-137334317 GAGGAAAAGAACAGTGATGGTGG - Intronic
939276156 2:139999043-139999065 GAGGAGAAGAAATATTATGAAGG - Intergenic
939280071 2:140052541-140052563 GAGAAGAAGAAAGAGGAGGAAGG + Intergenic
939459072 2:142476102-142476124 GAGGAAGAGAGAAAGGAGGGAGG + Intergenic
939691321 2:145265208-145265230 TAGTAGGAGAAAAATGAGAGGGG - Intergenic
939756984 2:146126390-146126412 GAGGAGGAGAAAAGAGAGGTAGG - Intergenic
939980608 2:148776427-148776449 GGGGAGAGGAAAGATAAGGGGGG - Intronic
940391379 2:153136448-153136470 GAGGAGTAGAAATATGATTGCGG + Intergenic
940640587 2:156341777-156341799 GGGGAGGAGAAAAAGGCGGGCGG + Intronic
940703966 2:157080842-157080864 GAGGTAAAGAGAAATGAGGCTGG + Intergenic
940761234 2:157741678-157741700 GAGGAGCAGAATAATGAGAAAGG + Intronic
941064600 2:160887245-160887267 GAGGAGGAAATAAATGAGAGTGG + Intergenic
941228812 2:162883163-162883185 AAGGAGAAGGAAAGTGATGGTGG + Intergenic
941272280 2:163445214-163445236 GAAAAGAAGAAAAAAGAGAGAGG - Intergenic
941396478 2:164980275-164980297 GAGGAGAAGAAGGAGGAGGTGGG - Intergenic
941444546 2:165584294-165584316 GAGGGCTAGAAAAATGAGGCTGG - Intronic
941609428 2:167642693-167642715 TATGAGAAGAAAAATAAGGCAGG - Intergenic
941989092 2:171537381-171537403 GAGGAGAAAAAGCATGAGGAGGG + Intronic
942350781 2:175050702-175050724 GAGGAGGAGGAAGAGGAGGGTGG + Intergenic
942494661 2:176527117-176527139 GAAAAGAGGAAAAAGGAGGGTGG - Intergenic
942528993 2:176888057-176888079 GAGGAGCTGAAAACTGAGGCAGG + Intergenic
942539496 2:177001062-177001084 GAGGAGAAAATGAATGAGGACGG - Intergenic
942683568 2:178507232-178507254 TGGGGGAAGAAAAATGTGGGAGG - Exonic
942715265 2:178884569-178884591 AAGGAAAACAAAAAGGAGGGAGG - Intronic
942984401 2:182121976-182121998 GAGGAGAAGAGAAGTTTGGGAGG - Intronic
942985413 2:182134781-182134803 GAGGAGCAGCAGGATGAGGGTGG + Intergenic
943188148 2:184640249-184640271 GAGGAGAAGAAGAAGAAAGGAGG + Intronic
943278271 2:185896885-185896907 GAGGAGAAGGAAGAAGAGGAGGG + Intergenic
943301623 2:186209874-186209896 TAGGAGAAGAAAAAAGTTGGAGG - Intergenic
943452925 2:188068036-188068058 GAGGACAAGAAAAATATGAGGGG + Intergenic
943557166 2:189419907-189419929 GAGGAGGAGAAGAAGGAGAGGGG + Intergenic
945073697 2:206015977-206015999 GTGCAGAAGGAAAATGTGGGTGG + Intronic
945076479 2:206044602-206044624 GAGATAAAGAAAAATGAGGATGG + Intronic
945155165 2:206830429-206830451 GAGAAGAAGAAGAAGAAGGGGGG + Intergenic
945213723 2:207411687-207411709 GAGGAGAGGAAAAGAGACGGGGG - Intergenic
945274025 2:207970218-207970240 GAGGAGAGGAAAGAGGAGGTAGG + Intronic
945890531 2:215426014-215426036 GAGGAGAAATAAAATGTGGAAGG - Intronic
945966056 2:216188066-216188088 TAGGGGAAGAAAAAAGAGTGAGG - Intronic
946070381 2:217029768-217029790 GAGGGGAAGAAAAGTGGTGGTGG + Intergenic
946148809 2:217750326-217750348 GAGGAGGAGGAAGAAGAGGGGGG + Intronic
946252872 2:218424122-218424144 GAGGAGAAGAAAACTGTGAGGGG - Intronic
946346302 2:219113644-219113666 GAGGGGGAGAAAAATGAGAGTGG - Intronic
946382091 2:219355648-219355670 GAGGAGGAGAAAAATTAGGATGG - Intergenic
946448064 2:219756622-219756644 GAGGAGAAGAAAAACCACAGAGG + Intergenic
946474735 2:219996322-219996344 TAGGAGGTGAAAAATGAAGGTGG - Intergenic
946688139 2:222291694-222291716 GGGGAGAAGAAAGCTGAGGGAGG - Intronic
947069036 2:226265391-226265413 GAGGAGGAGACAAAGGAGAGGGG - Intergenic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
947299403 2:228672075-228672097 GAATAGAATAAAAAGGAGGGAGG - Intergenic
947833381 2:233158016-233158038 GAGGAGAAGGAAGAAGAGAGAGG + Intronic
947930578 2:233961598-233961620 GAAAAGAAGAAAAAAGAGGCCGG - Intronic
948011748 2:234654256-234654278 GAGGAGAAAAAGGCTGAGGGAGG + Intergenic
948075078 2:235159603-235159625 CAGGAGAAGAAAAGAGAGTGTGG + Intergenic
948146918 2:235715152-235715174 GAGGAGGAGAGACAGGAGGGAGG - Intronic
948724537 2:239925242-239925264 AAAAAGAAGAAAAATGTGGGAGG + Intronic
1168832340 20:853465-853487 GAGGAGAAGAAAGATAGGAGTGG + Intronic
1168849255 20:965389-965411 GAGGAGGAAAAAAATGATGGGGG + Intronic
1168854769 20:1000991-1001013 AAGGGGAAGGAAAATGAGAGAGG - Intronic
1168863580 20:1064278-1064300 AAGAGGAAGAAAAAGGAGGGAGG + Intergenic
1168981019 20:2003617-2003639 TAGGAGAAGAAAAAGCAGTGAGG - Intergenic
1169092615 20:2870910-2870932 GAAGAGAAGAGAACTGAGGAAGG - Intronic
1169323604 20:4656281-4656303 GAGAAGAAGAGAAATGAAGTGGG - Intergenic
1169546710 20:6657800-6657822 AAGGAAGAGAAAAATAAGGGAGG + Intergenic
1169792058 20:9421631-9421653 GAGGAGAACCAAAAGGAGGCAGG - Intronic
1169799669 20:9502164-9502186 AAGAACAAAAAAAATGAGGGCGG - Intergenic
1170311474 20:14997151-14997173 AAGGAGAAGGAAAAGGAGTGGGG + Intronic
1170540384 20:17381753-17381775 GTGGAGAAAAAAAGGGAGGGTGG - Intronic
1170781593 20:19430419-19430441 GAGGAAGAGAAAAAATAGGGAGG + Intronic
1170821338 20:19758158-19758180 GAGGAGAGGAAAGAGGAGGAGGG - Intergenic
1170867693 20:20174666-20174688 GTGGAGGAGAGAAAGGAGGGTGG + Intronic
1170875766 20:20248563-20248585 GAGGAGAAGGAACAGGAGGCAGG + Intronic
1171539693 20:25938104-25938126 GAGGAAAAGAAGAAAGAGAGTGG - Intergenic
1171562282 20:26136444-26136466 TGGGAGGAGGAAAATGAGGGAGG + Intergenic
1172350567 20:34236136-34236158 GAGGAAAGGAGAAAGGAGGGAGG + Intronic
1172548999 20:35784346-35784368 GAGGGGAAAAAAAATGTGGCCGG - Intronic
1172788730 20:37487682-37487704 AAGGGGAAGACAAGTGAGGGTGG - Intergenic
1173019394 20:39254411-39254433 CACGAGAAGAAGAAGGAGGGAGG - Intergenic
1173317629 20:41959338-41959360 GAGGAGAAGCTAAGTCAGGGAGG + Intergenic
1173678246 20:44856968-44856990 GAGGAGAAGAAGAAGGGGAGGGG + Intergenic
1174709531 20:52690281-52690303 AAGGAGAAGAAAAAGGAGAAGGG - Intergenic
1174752648 20:53127037-53127059 GAAGAGAAAAAGAAAGAGGGAGG + Intronic
1174755127 20:53150716-53150738 GAGGAAAAGAAAAAGAAGGAGGG + Intronic
1174820796 20:53725069-53725091 GAGGAGATGAAAAATATGGCCGG - Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175254913 20:57636128-57636150 AGGGAGAAGAAAAATGATGTAGG + Intergenic
1175293733 20:57894868-57894890 TGGGAGAAAGAAAATGAGGGAGG + Intergenic
1175487423 20:59355820-59355842 GAGGAGAGGAGAAGAGAGGGGGG - Intergenic
1175587861 20:60159811-60159833 GAGGCAAAGAAAGGTGAGGGAGG - Intergenic
1175609092 20:60335223-60335245 GAGGAGAAGAAAGAGGGGGCGGG - Intergenic
1175848784 20:62075426-62075448 GAGGAGAGAAGAAATGAGGCAGG + Intergenic
1175919562 20:62444331-62444353 GAGGTGAGGAGCAATGAGGGAGG + Intergenic
1176037867 20:63049156-63049178 GAGGAGGAGGAAGAGGAGGGAGG - Intergenic
1176104903 20:63381330-63381352 GAGGAGAAAGAAAAGTAGGGAGG + Intergenic
1176349662 21:5782493-5782515 GATGAGAAGAAAAAAGATAGAGG + Intergenic
1176356476 21:5903077-5903099 GATGAGAAGAAAAAAGATAGAGG + Intergenic
1176543983 21:8180563-8180585 GATGAGAAGAAAAAAGATAGAGG + Intergenic
1176562934 21:8363608-8363630 GATGAGAAGAAAAAAGATAGAGG + Intergenic
1177406262 21:20672608-20672630 CAGGAGAAGAAAAATAAATGAGG + Intergenic
1177496053 21:21894084-21894106 GAGGACAAGAGAATTGAGAGGGG - Intergenic
1177639821 21:23832680-23832702 GGGGAAAAGAAAAAAGAGAGAGG + Intergenic
1177902020 21:26927997-26928019 GAGATGAGGAAAACTGAGGGAGG + Intronic
1178057858 21:28819524-28819546 AAGGAAAAGAAAAATAAAGGTGG - Intergenic
1178427642 21:32491737-32491759 GAAGGGAAGAAAATGGAGGGAGG + Intronic
1178505256 21:33157401-33157423 GAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178505261 21:33157420-33157442 GAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178684557 21:34701044-34701066 TAGGAGAAAAAAAATCAGTGAGG + Intronic
1178835898 21:36097283-36097305 GAGAAGAAAAAAAGTGAAGGAGG - Intergenic
1179084849 21:38207579-38207601 GAGGAGAGGAGAAAAGAGGAGGG - Intronic
1179116674 21:38499708-38499730 GAGAAGGAGAAAGATAAGGGGGG + Intronic
1179366327 21:40761394-40761416 GAGGAGAGAAAAAAAGAGGGAGG - Intronic
1179412466 21:41172744-41172766 GAGGAAAGGGAAGATGAGGGAGG - Intronic
1179483999 21:41698002-41698024 GAGGAAAAGAAACAGGTGGGTGG - Intergenic
1180210986 21:46295476-46295498 GAGGAGGAGGAAGAGGAGGGAGG - Intronic
1180689409 22:17698928-17698950 AAAGAGAGGAAAAAAGAGGGAGG - Intronic
1180904675 22:19401045-19401067 GAGGAGAAGAAAAGGGGGAGTGG - Intronic
1181314652 22:21963567-21963589 CAGGAGAAGGCAAATGAGGAAGG - Intronic
1181761559 22:25062239-25062261 GAGGAGGAGAAAAGAGAGGAAGG - Intronic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1181964053 22:26644225-26644247 GAGGAGAAAAAAAAAAAGAGGGG - Intergenic
1182022459 22:27092156-27092178 GAGAAGAAGAAAAAAGAAAGAGG + Intergenic
1182151251 22:28028617-28028639 GAAGGGAAGAAGGATGAGGGAGG + Intronic
1182185833 22:28401171-28401193 GAGGAGAAGGAAAAGGAGGGGGG + Intronic
1182207182 22:28640295-28640317 GAGGAGAAAAAAAGTAAAGGGGG + Intronic
1182286326 22:29250349-29250371 GAGAAGAAGAAAAAGGCAGGAGG - Intronic
1182744266 22:32593605-32593627 GAGGAGGAGGAGAAGGAGGGAGG + Intronic
1182773989 22:32817590-32817612 GACCAGAAGAAAAAGGAGGAAGG + Intronic
1182897935 22:33874017-33874039 GAGGAGAAGAATAAAGGAGGAGG - Intronic
1183309348 22:37101092-37101114 AAGGAGCAGAGAAATGGGGGAGG + Intronic
1183868831 22:40725226-40725248 AAGGAGAAGGAAGATGAGGGTGG - Intergenic
1184412339 22:44332392-44332414 GAGGAGAGGAAAAGGGAGTGGGG - Intergenic
1184527631 22:45034933-45034955 GAGGAAATGAGAAAGGAGGGAGG + Intergenic
1184984030 22:48117284-48117306 AAGGAGAAGGGAAATGAAGGAGG + Intergenic
1203248852 22_KI270733v1_random:96786-96808 GATGAGAAGAAAAAAGATAGAGG + Intergenic
949986487 3:9545237-9545259 GAGGAAGAAAGAAATGAGGGAGG + Intronic
950148673 3:10669419-10669441 GAGGTGAGGAGAAAGGAGGGTGG - Intronic
950269122 3:11599296-11599318 CAATAAAAGAAAAATGAGGGGGG + Intronic
950704865 3:14773403-14773425 GAGGAAGAAAAAAGTGAGGGGGG + Intergenic
951186266 3:19717041-19717063 GAAAAGAAGATAAAAGAGGGAGG - Intergenic
951251376 3:20397748-20397770 GAGTATAAGAAAAAGGAGGTTGG + Intergenic
951386231 3:22045971-22045993 GGGAAGAAAAATAATGAGGGAGG + Intronic
951481905 3:23170059-23170081 GAGGACAAGATAAGTCAGGGAGG + Intergenic
951645042 3:24880336-24880358 GAGCAGAGGAAAACTGGGGGTGG + Intergenic
951745996 3:25978219-25978241 GAGGAGAACAGAAATGGGAGAGG - Intergenic
951832488 3:26946001-26946023 GAGCAGAACAGAAATGAAGGAGG + Intergenic
951904252 3:27688451-27688473 GAGGAGAGGAAAGATTGGGGAGG + Intergenic
951974354 3:28487828-28487850 TAGGTGAAGAAAAAAAAGGGGGG - Intronic
952071821 3:29646701-29646723 GAAGGGAAGAAAAATGAGAAGGG - Intronic
952107584 3:30087733-30087755 GAGGAGAAGGAGGAGGAGGGAGG - Intergenic
952121354 3:30248708-30248730 TAGGAGAAGAAGAATGAGATAGG - Intergenic
952354193 3:32570128-32570150 GAGGAGGAGGAACCTGAGGGAGG + Intronic
952439478 3:33311357-33311379 GAGAAAAAGAAAAGTGGGGGCGG - Intronic
953060605 3:39425746-39425768 GAGGAGAAAACAAAAGAAGGTGG + Intergenic
953201927 3:40785611-40785633 GAGGAGGAGAAGAAGGAGAGGGG - Intergenic
953428091 3:42812179-42812201 GAGGGAAAGAAAACTGAAGGGGG - Intronic
953501209 3:43436464-43436486 AAGGAGAAGAACAGTGAAGGTGG + Intronic
954038456 3:47866404-47866426 GAGGGGAAGAAAAAGGAGGAAGG + Intronic
954050805 3:47975470-47975492 GAGGAGAAAAATAGAGAGGGAGG + Intronic
954173374 3:48823504-48823526 GAGGAGAAGAAAAATACAGTTGG + Intronic
954264492 3:49461850-49461872 GAGGAGGAGGAGAAGGAGGGTGG - Intergenic
954572593 3:51654625-51654647 GAGGGGGAAAAAAAAGAGGGAGG - Intronic
954725298 3:52603516-52603538 GAGAAGAAGAAAAAAGAGGTTGG - Exonic
954862824 3:53704405-53704427 GAGGATCAGAAGACTGAGGGAGG + Intronic
955300220 3:57771188-57771210 GAGGAGGAGAAAGAGAAGGGAGG - Intronic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955529203 3:59855311-59855333 GACAAGAAGATAAATGGGGGAGG - Intronic
955660124 3:61289865-61289887 GAGGAGAAGAAATAGGACGAAGG + Intergenic
955961727 3:64347557-64347579 AAGGAAAAGAAAAACGAGGACGG + Intronic
956101181 3:65770077-65770099 GAGGACAAGAAAGGTGAGAGAGG + Intronic
956102096 3:65779168-65779190 GTGAAGAAAAAAAATGAGTGAGG - Intronic
956375733 3:68611504-68611526 GAGGAGAAGAGAATTGGGGCAGG + Intergenic
956547776 3:70424958-70424980 GAGGAGGAGAAAAAGAAGGAGGG + Intergenic
956683768 3:71805352-71805374 GAGGAAGAGAGAAATGGGGGAGG - Intergenic
956846519 3:73188762-73188784 AAAGAGAAGAAAAAAGGGGGAGG - Intergenic
956905328 3:73759569-73759591 GAGGAAAGGAAACAGGAGGGAGG - Intergenic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
957309721 3:78504446-78504468 TAGAAGGAAAAAAATGAGGGAGG + Intergenic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957501709 3:81066518-81066540 GAGGAGGAGGAAGAGGAGGGAGG - Intergenic
957683444 3:83469787-83469809 GAGGAGAGGAGAGATGAGAGAGG + Intergenic
958154597 3:89740355-89740377 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
958475641 3:94577517-94577539 AAGGAGAAGAACAAAGATGGAGG + Intergenic
958510678 3:95043755-95043777 GAGAAGGAGAAAAAAAAGGGGGG - Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959502754 3:107125267-107125289 AAGGAGAAGAAAAAAAAGGGGGG + Intergenic
959652011 3:108759223-108759245 GAAGAGAAGAAAAATGAGACTGG + Intergenic
959711645 3:109391605-109391627 GAGGAGAAAAAAAATTAGAGAGG + Intergenic
959725081 3:109533626-109533648 GAGGAGAAGGAAAAGCAGGGAGG - Intergenic
959927930 3:111945717-111945739 AAGGAGAAGCAAAATAAGAGAGG - Intronic
960363448 3:116742266-116742288 GAGAAGAAAAAAAAAAAGGGGGG + Intronic
960376260 3:116905468-116905490 GAGTAGTAGTATAATGAGGGTGG + Intronic
960408601 3:117293142-117293164 GGGAGGGAGAAAAATGAGGGAGG + Intergenic
960427825 3:117530790-117530812 AAGGAGAAGAAAGATGAAGAGGG - Intergenic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960465845 3:117996495-117996517 GAGGAGGAGAAGAGGGAGGGAGG - Intergenic
960999952 3:123367536-123367558 GAGGAGGAGGAAGCTGAGGGTGG - Intronic
961345538 3:126260954-126260976 GGGGAGAAGGAAGAGGAGGGAGG - Intergenic
961529274 3:127530228-127530250 GAAAGGAAGAAAGATGAGGGTGG + Intergenic
961589301 3:127963767-127963789 GAAGAGAAGAGAAATGGGAGAGG + Intronic
961947704 3:130711440-130711462 GTGGAGCAGAGAAATGAAGGAGG + Intronic
962054400 3:131854733-131854755 GAGGAAAAGAATAAAGATGGAGG - Intronic
962334468 3:134514375-134514397 AAGGAGAAAAAAAATGAGAATGG + Intronic
962376739 3:134864516-134864538 GAGGAGAGAAAAAGGGAGGGAGG - Intronic
962555224 3:136543167-136543189 GAGGTTTAGAAAAATAAGGGAGG + Intronic
962649609 3:137475487-137475509 GAGGAGAGGAAGAGAGAGGGAGG - Intergenic
962842815 3:139251344-139251366 GAGAGGAGGAAAAAGGAGGGAGG - Intronic
962952186 3:140229486-140229508 GAGAAAAAGGAAAAGGAGGGTGG - Intronic
963049325 3:141128034-141128056 GAGGAGAAGAAAAAGAAGGCTGG + Intronic
963550000 3:146707924-146707946 GAGGAGAAGGAACAAGATGGTGG + Intergenic
964037317 3:152215164-152215186 GAGGAGAAGGAAATTTTGGGTGG + Intergenic
964389987 3:156186783-156186805 GAGGAGTATAAAAGGGAGGGAGG - Intronic
964407161 3:156361139-156361161 GATGAGAAGAATGATGAGGGCGG - Intronic
964564316 3:158033112-158033134 AAGAAGAAGAAAAAGAAGGGTGG + Intergenic
964570861 3:158106181-158106203 GAGGAGAAGAAAGAAGAAAGAGG + Intronic
965172184 3:165279927-165279949 GAGGTGAAGAAGAAGGAGGAGGG - Intergenic
966248404 3:177834477-177834499 AAGGAGAACAAAGAGGAGGGTGG + Intergenic
966319462 3:178685020-178685042 GAGTAGAAGAGGAAGGAGGGAGG - Intronic
966476079 3:180348306-180348328 GAAGAGTGGAAAAATGAGAGAGG - Intergenic
966585118 3:181615149-181615171 GAGGAAACAAAAAAGGAGGGAGG + Intergenic
966767405 3:183475674-183475696 AAGGAGAAGAAAAATGTAGATGG + Intergenic
966908923 3:184547186-184547208 GAGCAGGAGAAAAAAGAAGGAGG + Intronic
966949594 3:184804189-184804211 GAGGAGGAGAAAAATAGGGCTGG - Intergenic
967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG + Intronic
967341708 3:188405910-188405932 GAGGAGGAGGAAAAGGAGGAAGG - Intronic
967365483 3:188681660-188681682 AAGGAGAAGGAAAAGGAGGGAGG + Intronic
967410412 3:189161251-189161273 TAGCAAAAGAAAAATGAGAGAGG - Intronic
967433051 3:189410833-189410855 GAAGAGAAGAGAAAAGAGGGAGG - Intergenic
967607326 3:191462984-191463006 AAGAAAAAGAAAAAAGAGGGAGG - Intergenic
968138311 3:196235388-196235410 GAAGAGAAAAAATATGAGGGAGG - Exonic
968323178 3:197789721-197789743 GAGCAAAAGAAAAATAAGGATGG - Intergenic
968424614 4:514185-514207 AAGGAGAAGGGAAATGAGTGTGG - Intronic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968625190 4:1623840-1623862 GAGGAGAAAAAAGTTGAGGAGGG + Intronic
968844485 4:3032479-3032501 GAGGGGAAGAAAAATAAAGCAGG + Intronic
969442885 4:7227709-7227731 GGGGAGAAGAAACAGGAGAGAGG - Intronic
969453614 4:7288585-7288607 GAGGAGAAGAGAGAGGAGAGAGG + Intronic
969479533 4:7440695-7440717 GAGGAGAGGCAGCATGAGGGTGG - Intronic
969561805 4:7953137-7953159 GAGGAGGAGAAAGAAGAGGAGGG + Intergenic
969680902 4:8642853-8642875 GACAAGAAGGAAAATGTGGGTGG - Intergenic
970095399 4:12458338-12458360 GAGGGGAAGAAAAAAGAGTAGGG - Intergenic
970142846 4:13001293-13001315 TAGGAGAAGAAAAATGACCTAGG - Intergenic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970260132 4:14215864-14215886 GATGATAAGGAAAATGAGGAAGG + Intergenic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
970365212 4:15351262-15351284 GAGGAGGAGAAAACAGAGGAAGG - Intronic
970506166 4:16732770-16732792 GAGGGAAAGAAAATTGTGGGAGG + Intronic
970862967 4:20724438-20724460 GAAGAGAAGACAAAGGATGGAGG - Intronic
970867245 4:20773288-20773310 TAGGAGAAGGCAAAGGAGGGTGG - Intronic
971633841 4:29031426-29031448 GAGGAGGAGAAAGAGGAGGAGGG - Intergenic
972153717 4:36129693-36129715 GAAGAGAAGAGAATTGAGGAAGG - Intronic
972207091 4:36786915-36786937 GAGGAGAAGAAAATTAAGCCAGG - Intergenic
972372770 4:38440709-38440731 GAGGAGGATAAAAAAGAAGGAGG + Intergenic
972384506 4:38551740-38551762 GAGGAGAAGACAATTGAAAGAGG + Intergenic
972774990 4:42232170-42232192 GAAGAGAGGAAAAAGGAGAGAGG + Intergenic
972856475 4:43113730-43113752 GAGGAGAGGAAAAGGGAGAGTGG + Intergenic
972897476 4:43641317-43641339 GAAGAGAAGAAAAAAGAGGAGGG - Intergenic
973087355 4:46082314-46082336 GAGAAGAAGAGAAATAAGGGAGG - Intronic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973151960 4:46899112-46899134 GAGGAGAAGGATAATGAGTTGGG - Intronic
973305152 4:48639254-48639276 AAGGAGAAGAAAAATGTCAGAGG + Intronic
973594175 4:52468613-52468635 AAAGAGAAGAAAAATGTTGGAGG - Intergenic
973802320 4:54491660-54491682 CTTGAGAAGAAAAATGAGTGGGG + Intergenic
974332769 4:60501097-60501119 GAGGAAAAGAAAAAAAAGTGGGG - Intergenic
974435897 4:61856933-61856955 AAAGAGAAGAAGAAAGAGGGAGG - Intronic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
974891602 4:67890763-67890785 GAGGAGAAGTAAACTGATGTTGG - Intergenic
975028214 4:69578510-69578532 GAGAAGAAGAAGAAAGAAGGAGG - Intergenic
975346759 4:73300590-73300612 GAGGAGAAGAGGAAGGAGAGAGG + Intergenic
975662956 4:76705603-76705625 AAGTAGAAGAAATATGTGGGTGG + Intronic
975757010 4:77580842-77580864 GAGGAGAGGAAAAGGGAGAGGGG - Intronic
975884723 4:78951397-78951419 GAGGAGCTGAAAAAGGAGGTGGG + Intergenic
976324823 4:83759246-83759268 GAGAAGAAGAAAACAGAGAGAGG + Intergenic
976402038 4:84618448-84618470 GAAGAGAAGATAAATAAGGATGG + Intronic
976635111 4:87279564-87279586 GAGGAGAGGCAGAATGAGGCGGG + Intergenic
976739187 4:88341267-88341289 GAGGAGAACACAAATGAAGCAGG - Intergenic
976777185 4:88719599-88719621 GAGGAGGAGAAAGAGAAGGGGGG - Intergenic
976777200 4:88719676-88719698 AAGGAGAAGAAAAAAGGAGGAGG - Intergenic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
977416890 4:96744243-96744265 GAGGAGGAGAACAAAGAGGGAGG - Intergenic
977455329 4:97252510-97252532 GAAGGGAAGAAAAAGGAGGGTGG - Intronic
978021240 4:103815487-103815509 AAGGAGAAGAAAAAAGAGAAGGG - Intergenic
978173081 4:105697421-105697443 GAAGAGAAGAAAAAGGAAGGAGG + Intronic
978310268 4:107379607-107379629 GAGAAAAAGAAAAATGAGGTGGG - Intergenic
978346755 4:107777998-107778020 GAGGAGAGGAAAAGAGAGGAGGG + Intergenic
978637917 4:110832905-110832927 GAGAAGAAGAAAGAGGAGGCAGG + Intergenic
978922473 4:114201020-114201042 GAAGAGAAGAAAAAGTAGGAAGG - Intergenic
978936622 4:114385258-114385280 GAGAGAAAGAAAAATAAGGGAGG + Intergenic
979113073 4:116783212-116783234 GCAGAGAAGAACAATGAGGCAGG + Intergenic
979156944 4:117406145-117406167 GTGGAGAAGAAAAATCAAGATGG + Intergenic
979375455 4:119941502-119941524 GAGGAGGAGAAAGAGGAGGAGGG - Intergenic
979386955 4:120078104-120078126 GAGGAAAAGAAACAAGAGGTAGG + Intergenic
980017216 4:127663817-127663839 TAGGAAAAGAAAAAAGAGGAAGG + Intronic
980138311 4:128883267-128883289 GAGGGGAAGAATAGTGTGGGAGG + Intronic
980581595 4:134761583-134761605 TAGGAGAAGAAAAAAGTGGGAGG + Intergenic
980723580 4:136728187-136728209 GAGGAGAAGAAAGAGTGGGGAGG - Intergenic
980875914 4:138661975-138661997 GAGGACTAGGAAAATGAGGTTGG - Intergenic
980894974 4:138853323-138853345 GAGGAGGAGAGAAGAGAGGGAGG + Intergenic
980909243 4:138978800-138978822 GAGGACTAGGAAAATGAGGCTGG + Intergenic
980995322 4:139774643-139774665 GAAGAGAAAAAAATTGACGGAGG + Intronic
981018477 4:140000637-140000659 AAGGAGAAGAAGAATGGCGGTGG + Intronic
981223918 4:142269293-142269315 GAAGAGAGGAAAAAAGAGGGGGG - Intronic
981310039 4:143288852-143288874 GATGTGAATAAAAAGGAGGGAGG - Intergenic
981408859 4:144404125-144404147 AAGGAAAGGAAAAAAGAGGGAGG + Intergenic
981945366 4:150336565-150336587 GGGGAGAAGGAAAATTAGGGAGG + Intronic
982144792 4:152374230-152374252 GAAGAGAAGAAAGAATAGGGTGG - Intronic
982222161 4:153134249-153134271 GTGCAGAAGAAAGGTGAGGGAGG - Intergenic
982274861 4:153628319-153628341 AAAGAGAAGAAAAATGAGGGAGG - Intronic
982429637 4:155308021-155308043 GAGGAAGAGACAAATGTGGGTGG - Intergenic
982977967 4:162090957-162090979 GAGGAGCAGAAAGGTGATGGAGG - Intronic
982988289 4:162238386-162238408 CATGAGAAGCCAAATGAGGGAGG - Intergenic
983351243 4:166592901-166592923 GAGGAAAAGAAAGAGGAGGGGGG - Intergenic
983432499 4:167669454-167669476 GAGGTGGAGAAATATGGGGGTGG - Intergenic
983449388 4:167891536-167891558 AAGGAGAGGAAAAAAGAGGTGGG + Intergenic
983934021 4:173486629-173486651 GAAGAAAAGAAAAAGGAAGGAGG - Intergenic
983958892 4:173728266-173728288 GAGGGCAAGACAAAGGAGGGTGG - Intergenic
984256120 4:177392020-177392042 GGGCAGAAGAAAGATGAGAGTGG + Intergenic
984387084 4:179074456-179074478 GAGGATTAGAAAAAGGGGGGGGG + Intergenic
984403146 4:179292767-179292789 GAGCAGAGGAAAACTGAGGGAGG - Intergenic
984403153 4:179292813-179292835 GAGCAGAGGAAAACTGAGGGAGG - Intergenic
984406392 4:179337247-179337269 GCAGAGAAAAAAAATTAGGGTGG + Intergenic
984407800 4:179355783-179355805 CAAGAGAAGAAAAATGAAGTAGG - Intergenic
985140607 4:186836734-186836756 GAGGAAGAGAAAAGAGAGGGAGG - Intergenic
985140610 4:186836753-186836775 GTAGAAAAGAAAAAAGAGGGAGG - Intergenic
985756642 5:1723427-1723449 GAGGAAAAGAGAAAGGAGGAGGG - Intergenic
985759797 5:1741882-1741904 AAAGAGAAGAAAAATTACGGAGG - Intergenic
986009681 5:3700900-3700922 GAAAAGAAGAAGAAGGAGGGAGG - Intergenic
986278658 5:6304545-6304567 GAGGAAAAGAAAAAGGAGACGGG + Intergenic
986811979 5:11369711-11369733 GTGTTGAAGAAAAATGAGGCAGG + Intronic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
987191416 5:15482393-15482415 GCTGAGTAGAAAAAGGAGGGAGG + Intergenic
987442158 5:17968967-17968989 GAGAAGAAGACTAATGAGGAGGG - Intergenic
987474533 5:18374629-18374651 GAAGAGAAGAAAAAGGAGTTAGG - Intergenic
987678359 5:21104778-21104800 GAGGAGCAGGAAGATGAAGGTGG + Intergenic
987766708 5:22240974-22240996 GAGGAGAAGAGAAAGAATGGAGG + Intronic
987799014 5:22668837-22668859 GAGGAGAAGAGATAAAAGGGTGG - Intronic
987823055 5:22991119-22991141 GAGGAGAAGAAAAAGTAAAGAGG + Intergenic
987942910 5:24565171-24565193 GAAGAGAAGAAAAAGGGAGGAGG + Intronic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988174006 5:27696798-27696820 GAGAGGGAGAAAAAGGAGGGAGG + Intergenic
988677269 5:33445336-33445358 GAAGAGAAGCAAAAGGAAGGAGG + Exonic
988839268 5:35067057-35067079 GAGGATAAGAAAAAAGAGGCCGG - Intronic
988890306 5:35609509-35609531 GAGGAGAAGGTAAGAGAGGGAGG - Intergenic
989181007 5:38577167-38577189 GATGAGAAGAAAGGAGAGGGAGG - Intronic
989253267 5:39340039-39340061 GAGGAGAGGAAAAAAGACAGGGG - Intronic
989279023 5:39620822-39620844 GTGGAGAAGAAAAAGGATGTAGG - Intergenic
989375090 5:40752925-40752947 GGTGAGAAAAAAAGTGAGGGTGG + Intronic
989410135 5:41110844-41110866 GAGGAGAAGGAAGAGGAAGGGGG - Intergenic
989488167 5:42016355-42016377 AAGGAAAAAAAAAAGGAGGGAGG - Intergenic
989556826 5:42806638-42806660 GAGGAGGAGAAAGAAGAGGAAGG + Intronic
989586036 5:43074479-43074501 GAGGAGAAAGACAATCAGGGTGG + Intronic
989756220 5:44958785-44958807 GAGAAGAAGGAAAAAGAAGGAGG - Intergenic
989800789 5:45536071-45536093 GAGGAGAATACAAATGAAAGTGG - Intronic
989812856 5:45697617-45697639 GAGGAAAAAAAAAATGAGTGGGG + Intergenic
989995113 5:50819852-50819874 GAGTAGAAGGAATGTGAGGGTGG + Intronic
990173254 5:53078917-53078939 GAGAAGAAAAAAAATGAGTCTGG + Intronic
990198616 5:53346429-53346451 CAGGAAAAGAGAAATGAGGCTGG + Intergenic
990472778 5:56131835-56131857 GAAGAGAAGAAAAATGATATAGG + Intronic
990537991 5:56742728-56742750 GAGAAGAAGAAGAAGGGGGGAGG - Intergenic
990537992 5:56742731-56742753 AAGGAGAAGAAGAAGAAGGGGGG - Intergenic
990549141 5:56855113-56855135 GAGGAGGAGAAAAAGGAGGAGGG - Intronic
990925676 5:61019412-61019434 GGGGAAGAGTAAAATGAGGGAGG - Intronic
991357791 5:65787959-65787981 GAGGAGGAAAAACGTGAGGGAGG - Intronic
991422497 5:66455491-66455513 GGGGAAAGGAAAAATGAGGTGGG - Intergenic
991669965 5:69037800-69037822 GAGAAAAAGGAAAATGAGGCTGG + Intergenic
991924801 5:71694492-71694514 GAGGAGAAGTAGAAAAAGGGAGG - Intergenic
992112595 5:73510072-73510094 GAGAAGGAGGAAAGTGAGGGAGG + Intergenic
992321224 5:75614907-75614929 GAGGAAAAGAATGGTGAGGGAGG + Intronic
992433480 5:76732397-76732419 GATGAGGAGAAAAATGAAAGTGG + Exonic
992629661 5:78667956-78667978 AAGGGGAAGAAAAAGGAGGAGGG - Intronic
992676943 5:79114447-79114469 GAAGAGAATGAAAATGAGGGAGG + Intronic
992813985 5:80418221-80418243 GAGGAGAAGAGAAAGGAGAGAGG - Intronic
992990195 5:82275977-82275999 TAGGATAAAAAAAATAAGGGGGG + Exonic
992994458 5:82318661-82318683 GAGGAGGAGGAAAGGGAGGGAGG + Exonic
993235540 5:85303880-85303902 GAAAAGGAGAAAAATGAGTGTGG - Intergenic
993416053 5:87633056-87633078 AAGGAGAAGAAAAAAGTTGGAGG + Intergenic
993425362 5:87757035-87757057 GGGGAAAAGAAAAAGGAGAGAGG - Intergenic
993456575 5:88133987-88134009 GAGGAGGAGAAAGAAGAGGAAGG + Intergenic
993752131 5:91683218-91683240 AAGGAGAAGGAAAATCAAGGAGG - Intergenic
993852689 5:93030943-93030965 GAAGAAAAGAAAAAAAAGGGAGG + Intergenic
994102493 5:95909115-95909137 ATGGAGAAGACAAATAAGGGAGG + Intronic
994187467 5:96831196-96831218 CAGGAGAAGAGAGAGGAGGGAGG + Intronic
994205430 5:97029785-97029807 GGAAAGAAGAAAAATGAGGGAGG + Exonic
994412071 5:99419538-99419560 AAGGAAAGGAAAAAGGAGGGAGG - Intergenic
994481753 5:100345722-100345744 AAGGAAAGGAAAAAGGAGGGAGG + Intergenic
994913680 5:105945620-105945642 AAGAAGAAGAAAGAAGAGGGAGG + Intergenic
995214732 5:109582348-109582370 GAGGAGAAGGAAGAGGAGGGGGG + Intergenic
995690571 5:114821921-114821943 AAGTAGAAAAAAAAAGAGGGAGG - Intergenic
996165745 5:120220734-120220756 GAGGAGGAGGAAAAGGAGGTGGG - Intergenic
996425388 5:123308097-123308119 GAGGAGAGGTAATATGAGGAAGG - Intergenic
996485300 5:124026687-124026709 GAAGAAAAGAAAAAAAAGGGGGG + Intergenic
996947448 5:129087713-129087735 AAAGAGAAGAAAAAGGAGGCAGG + Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997084271 5:130778519-130778541 GAGGAGAAGGAAGAAGAGGAGGG + Intergenic
997162495 5:131623985-131624007 GAGGAGTGGAAAAGTGAGGAAGG + Intronic
997330825 5:133060032-133060054 GAGGAGAAGCAAACTGATTGTGG + Intronic
997718161 5:136057452-136057474 GTGGCTAAGAAAAATGAGGAAGG + Intronic
997835452 5:137188598-137188620 GAGGAGAGGAAAACAGATGGGGG - Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
998879072 5:146628823-146628845 GAGGGCAAGAAAGATGAGAGGGG - Intronic
999178364 5:149648379-149648401 GAGGAGGAGAGCAAGGAGGGAGG - Intergenic
999551762 5:152695265-152695287 GCTGAGAAGAAAAATGAGGCTGG - Intergenic
999623035 5:153491242-153491264 GAGGAAAAAAAAAATCAGGCTGG + Intronic
999802814 5:155053556-155053578 GAGGAGAAGAGGATGGAGGGCGG + Intergenic
999889364 5:155960116-155960138 AGGGAGAAGAAAAAGGAGGGAGG - Intronic
1000142934 5:158424094-158424116 GGGGAGGAGAGAAATGAAGGAGG + Intergenic
1000209831 5:159098779-159098801 GAAGAGAAGAAAATAAAGGGGGG + Intronic
1000765530 5:165284753-165284775 AATGAAAAGAAAAATGAGGCTGG + Intergenic
1000797413 5:165682335-165682357 TAAAAAAAGAAAAATGAGGGGGG + Intergenic
1001100647 5:168811008-168811030 TAGGAGAAGAACAATGTGGCTGG - Intronic
1001490604 5:172152107-172152129 GAGTGGAAGAAAAATCAGTGGGG - Intronic
1001737725 5:174020407-174020429 AAAGAAAAGAAAAATGTGGGGGG - Intergenic
1001769883 5:174286309-174286331 GAGGAGGAGAAAGATGGGGGAGG + Intergenic
1002289824 5:178192671-178192693 GAGGAAAAGAAAAAGAAGTGTGG + Intergenic
1002327309 5:178418330-178418352 TAGGGCAAGAAAACTGAGGGTGG - Intronic
1002922024 6:1579777-1579799 GAGGAGGGGTGAAATGAGGGGGG - Intergenic
1002930240 6:1629385-1629407 GAGGAGAAGAAAACAGCAGGCGG + Intronic
1003020431 6:2504832-2504854 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003020438 6:2504868-2504890 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003145740 6:3508847-3508869 AAACAGAAGAAAAATGAGGAGGG - Intergenic
1003375456 6:5572679-5572701 GTGGAGAAGAGAAAAGATGGGGG - Intronic
1003406751 6:5832548-5832570 GAGGAGGAGGAAGAGGAGGGGGG + Intergenic
1003487878 6:6595360-6595382 GGGGAGAAGAAAGAAGAGAGGGG + Intronic
1003637105 6:7842391-7842413 GAGGAGAACAGAGATGGGGGTGG - Intronic
1003727229 6:8779031-8779053 CAGGTGAAAAAAGATGAGGGGGG - Intergenic
1003777885 6:9389882-9389904 GAGAAGATGAAAAAGGAGGCAGG + Intergenic
1003856940 6:10286045-10286067 GAGGAGGAGGAGAAGGAGGGAGG + Intergenic
1004109726 6:12705122-12705144 AAGGAGGAGAAAAGGGAGGGAGG + Intergenic
1004127435 6:12887207-12887229 GAGGAGAAGAACAATTGGAGTGG - Intronic
1004294458 6:14397563-14397585 GAGGAGAAGGCAATTGAGGAAGG - Intergenic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004404979 6:15324478-15324500 AAGAAGAAGAAAAAGGAGGGGGG - Intronic
1004577029 6:16906831-16906853 GAGGAAAAGAAAAAGAAGGAAGG + Intergenic
1004813125 6:19281692-19281714 AAGGAGAAAAAAAATGGGGTGGG + Intergenic
1004943548 6:20586888-20586910 GAAGAGCAAGAAAATGAGGGCGG - Intronic
1005081954 6:21965396-21965418 GAGGAGGAGAAGAAGGAGGAGGG - Intergenic
1005106079 6:22225786-22225808 GGGGAGAAGAGAAAATAGGGAGG - Intergenic
1005352202 6:24947708-24947730 GAGGAGAAGGAAAAAGTAGGGGG + Intronic
1005417094 6:25611589-25611611 GAGAAAAAGAAAAGTGAGGAAGG + Intronic
1005506869 6:26476975-26476997 GAGGAGGAAGAAAATGAGAGTGG - Intergenic
1005709434 6:28489661-28489683 GAGCAGAAGAAAACAAAGGGTGG - Intergenic
1005819470 6:29585770-29585792 TAGGAGAAAAATAATGAGAGTGG + Intronic
1006277587 6:33018046-33018068 GTAAAGAAGAAAGATGAGGGTGG - Intergenic
1007075499 6:39063660-39063682 GAGGAGAAGAAAGAGCAGGGAGG + Intronic
1007326006 6:41060123-41060145 AAGGAGAAGAAAAAAGAGAAGGG - Intronic
1007412721 6:41674284-41674306 GAGGAGAGGAAATCTGAGGGTGG - Intergenic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1007617776 6:43191937-43191959 GATGAGAAGAGAGATAAGGGTGG - Intronic
1007647453 6:43393970-43393992 CAGAAGAAGAAAAATGAGTAAGG + Intergenic
1007708130 6:43803935-43803957 GAGGAGAAGGAAGAGGAGAGAGG + Intergenic
1007791334 6:44310509-44310531 GTGGAGTAGAGAAATGGGGGGGG + Intronic
1007874401 6:45079406-45079428 GAGGAGAAGGAAGAAGAAGGGGG + Intronic
1008036401 6:46749562-46749584 GAGGAAAAGAAAAAAGCGGGGGG - Intronic
1008584797 6:52938734-52938756 GAGAAGAAGAAGAATGAATGGGG + Intergenic
1008694325 6:54016440-54016462 GAGCACTAGAGAAATGAGGGTGG - Intronic
1009593692 6:65708652-65708674 GAGGAGGGGAAAAGGGAGGGAGG - Intergenic
1009611643 6:65950318-65950340 AAGGAGAAGGAAAATGTGGTTGG - Intergenic
1010041671 6:71391907-71391929 GAGGAAGAGGAAAATGAGGCTGG - Intergenic
1010047982 6:71469801-71469823 GAAGAGAAGGCAAATGAGGAGGG - Intergenic
1010144570 6:72652388-72652410 GAGGGAGAGAAAAATGAGAGTGG - Intronic
1010486429 6:76420088-76420110 GAGGATAAGTAAACTGATGGAGG + Intergenic
1011085624 6:83537432-83537454 GAGAAAAAGAAAAGGGAGGGAGG - Intergenic
1011118633 6:83925220-83925242 GAGGAGGAGAGAGATGGGGGAGG + Intronic
1011354669 6:86461711-86461733 GAGGAGGAGGAAAAGGATGGGGG + Intergenic
1011656531 6:89557016-89557038 GGGAAGAAGAGAAATGGGGGAGG + Intronic
1011854298 6:91669598-91669620 GAGGAGCAGAAAGAAGAGGGTGG - Intergenic
1011869439 6:91874080-91874102 CCAGAGAAGAAAAATGAGGCTGG + Intergenic
1012048786 6:94312622-94312644 TAGTAAAAGAAAAATGAGGCCGG + Intergenic
1012091410 6:94902558-94902580 GAGGAGAAGAAAGAGTAGGAAGG + Intergenic
1012330965 6:97986600-97986622 AGGAAGAACAAAAATGAGGGTGG + Intergenic
1012553152 6:100482526-100482548 GAGGGGCAGCAAAGTGAGGGTGG + Intergenic
1012564887 6:100636426-100636448 GAGGAGAAGGAAAGAGATGGGGG - Intronic
1012931849 6:105325746-105325768 GAGGATAAGAACAAGGAAGGTGG + Intronic
1012961902 6:105630967-105630989 GAGGAGATAAAGAAGGAGGGAGG + Intergenic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013325239 6:109039100-109039122 GAGGAGAAGGAGAAGGAAGGAGG + Intronic
1013351928 6:109313605-109313627 GAGGAGAAGAAACAGGAGGTAGG + Intergenic
1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG + Intergenic
1014072015 6:117193232-117193254 GAGAAAAAGCAAAATGAGGTGGG - Intergenic
1014113302 6:117645454-117645476 GAGGACAAGCCAAAGGAGGGTGG + Intergenic
1014126132 6:117779268-117779290 GAGGAGGAGAAAAATGGGTGGGG - Intergenic
1014567947 6:122973866-122973888 GAGGAGACGAAGAATGAGGATGG + Intergenic
1014617553 6:123622128-123622150 GAGGAGGAGGAAAAAGAGGAAGG - Intronic
1014629832 6:123774590-123774612 GAGGAGTAGACAAATGAGAGTGG - Intergenic
1014776088 6:125511449-125511471 GAGGAGAAGAGAAAGGAGAGGGG - Intergenic
1015014930 6:128400940-128400962 GAGGGAAAGAAAAATGAGCAAGG + Intronic
1015141067 6:129932385-129932407 GAGAAAAAGAAAGAGGAGGGAGG + Intergenic
1015400695 6:132785055-132785077 AAGGAAAAGAAAAAAGGGGGAGG + Intronic
1015590608 6:134819331-134819353 GAGATGAAGAAAAATGAGGGGGG - Intergenic
1015845688 6:137518538-137518560 AAGGAGAAAAAAAAAGTGGGGGG - Intergenic
1015889635 6:137957007-137957029 AAAGAGAGGAAAAATTAGGGTGG - Intergenic
1016147703 6:140695967-140695989 GAGGAGCAGAATATTAAGGGTGG - Intergenic
1016404338 6:143714721-143714743 GAGAAGAAAAGAAATGAAGGGGG - Intronic
1016643534 6:146378187-146378209 GTGCAGAAGGAAAATGTGGGGGG + Intronic
1016801487 6:148173541-148173563 GAGGAGGAGGAAGAGGAGGGGGG + Intergenic
1016805401 6:148207143-148207165 GAGGACATGGAAAATCAGGGTGG - Intergenic
1017224661 6:152007025-152007047 GAGTAAAAGATAAATCAGGGTGG - Intronic
1017990276 6:159481679-159481701 AAGGAGAGGAAAAGTGAGTGGGG - Intergenic
1018306373 6:162461203-162461225 GAAGAGAAAAAAAAGGAGGCTGG + Intronic
1018613123 6:165662414-165662436 GAGGAGGGGAGAAAAGAGGGAGG + Intronic
1018705637 6:166461568-166461590 GAGGAGGGGAGAAATGGGGGAGG + Intronic
1018861771 6:167715655-167715677 GAGGAGGAGGAAGAGGAGGGTGG + Intergenic
1019198060 6:170293712-170293734 GAGGAGAAGGAAGAAGAGGAAGG - Intergenic
1019535285 7:1526144-1526166 GAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1019535309 7:1526231-1526253 GAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1019768833 7:2870776-2870798 GAGGAGAAGAGGAAGGAAGGAGG + Intergenic
1020135501 7:5585833-5585855 GGGGAGAAGAGAAGGGAGGGTGG + Intergenic
1020572962 7:9889853-9889875 GAGGAGAAGGAAGAAGGGGGAGG + Intergenic
1020800922 7:12731201-12731223 GAGGAGACGAGGAATGAGGAGGG - Intergenic
1020828136 7:13058019-13058041 GAGGAGAAGCAGAAAGAAGGAGG - Intergenic
1020887719 7:13840066-13840088 GAGGAGAAAAGAAAGGAGGAAGG + Intergenic
1021052102 7:15999543-15999565 GAAAAGAAGAAAAATGAGAGGGG + Intergenic
1021410156 7:20320933-20320955 GATGAGAAGAAGAATGAAGTAGG + Intergenic
1021850292 7:24801401-24801423 GAGGAGAAGAATCAGGAGGCTGG - Intronic
1022057034 7:26747808-26747830 GAGGAGAAGAGAGGAGAGGGAGG - Intronic
1022091557 7:27110980-27111002 GGGGAGAAGGAGAATGAGTGAGG + Intronic
1022146459 7:27546910-27546932 GAGGAGAAGAGAAATAAAGTAGG - Intronic
1022551302 7:31242024-31242046 GGGGAGAAGAGAAATGAGATAGG + Intergenic
1022642681 7:32203210-32203232 AAGAAGAAGAAATATGTGGGAGG - Intronic
1022651968 7:32285741-32285763 GGGGAGAAGAGAAGAGAGGGGGG + Intronic
1022717964 7:32915760-32915782 GAGGAGAAAAAAACAGAGTGAGG + Intergenic
1022866825 7:34430403-34430425 GAGCAGAAGAAAACCTAGGGAGG + Intergenic
1023026342 7:36053865-36053887 GAGGAGAAGAAGAATGTAGGAGG - Intergenic
1023095309 7:36654308-36654330 AAGAAGAAGAAAAAGGAGAGAGG - Intronic
1023163199 7:37318022-37318044 GAGGAGCAGAAAGATGGTGGGGG + Intronic
1023412171 7:39899040-39899062 GAGGAGAAGTAGGAGGAGGGTGG - Intergenic
1023565022 7:41515616-41515638 GAGAGGAAGAAAAATGATGTAGG + Intergenic
1023615168 7:42012378-42012400 GAGAAGAAGAAAAGGGAGGGGGG - Intronic
1024233103 7:47377767-47377789 GGGGAGAAGGAGAAGGAGGGAGG - Intronic
1024720954 7:52137076-52137098 GAGGAGGAGAAGGAGGAGGGAGG + Intergenic
1024786145 7:52910548-52910570 GAGGAGAAGAAGACCGATGGAGG + Intergenic
1024835407 7:53512336-53512358 GAGGAGAAAGAAAAAGAGAGAGG + Intergenic
1024999561 7:55303694-55303716 GAGGGGAAGGAAGAGGAGGGAGG + Intergenic
1025057917 7:55779961-55779983 AAGAAGATGAAAAATGAGGCTGG - Intergenic
1025284352 7:57650147-57650169 GAGCAGAAGAAGCAGGAGGGAGG + Intergenic
1025872640 7:65449204-65449226 GAGGAGAAGAGAAGGGAAGGGGG - Intergenic
1025951306 7:66147558-66147580 GATGAGAAGAAAGATGTGTGTGG + Intronic
1026078927 7:67199922-67199944 GAGAAGAAGAGAAGAGAGGGAGG + Intronic
1026146938 7:67754651-67754673 GTGGAGAAGAAACCTGAGAGGGG + Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026191906 7:68136493-68136515 GAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1026268522 7:68816448-68816470 GAGGAAGGGAAAAAGGAGGGAGG + Intergenic
1026350342 7:69510075-69510097 GAGAAGGATAAAAAGGAGGGAGG + Intergenic
1026697893 7:72612017-72612039 GAGAAGAAGAGAAGAGAGGGAGG - Intronic
1026837677 7:73649262-73649284 GAGGAGAGGAAGAGAGAGGGGGG - Intergenic
1026849702 7:73717184-73717206 GAGAAGGAGAAAGAAGAGGGAGG + Intronic
1026857256 7:73762918-73762940 GAGAAAAAGAAAGATGGGGGAGG - Intergenic
1026905094 7:74058337-74058359 AAGGAGAAGAAAGAAGAAGGAGG - Intronic
1027435754 7:78162863-78162885 GATGAGTAGAAAAATGATGTGGG - Intronic
1027599257 7:80218925-80218947 GATGAGTAAAAAAAGGAGGGTGG - Exonic
1027738840 7:81973565-81973587 GAGGAGAAGGAAAAGGAGGGAGG + Intronic
1028011736 7:85653629-85653651 AAGGAGAAGAAAAATTTGGTAGG - Intergenic
1028509653 7:91610175-91610197 CAGGAGAGGAAAAAGGAGGGGGG + Intergenic
1028618880 7:92801920-92801942 GAGGAGACGAAAAGAGAGGCGGG - Intronic
1028798089 7:94928078-94928100 GAGGAGAGGAATCATTAGGGAGG + Intronic
1029180759 7:98700053-98700075 AAGAAAAAGAAAAAGGAGGGAGG + Intergenic
1029184471 7:98728738-98728760 GAGGAGCAGAAAAAAATGGGAGG - Intergenic
1029284014 7:99453883-99453905 GGGGACAGGAAAAAAGAGGGCGG - Intronic
1029891359 7:103933515-103933537 GAGGGGAAGAGAAGGGAGGGAGG + Intronic
1030177110 7:106665948-106665970 GAGGAGAAAAAATATGAGGCTGG + Intergenic
1030318640 7:108141728-108141750 CTGGAGAGCAAAAATGAGGGTGG + Intergenic
1030397289 7:109002932-109002954 GAGGAGAAGAAGAAGCAGTGAGG - Intergenic
1030828479 7:114190699-114190721 GAGGAAAAAAGAAAAGAGGGAGG - Intronic
1031007567 7:116491097-116491119 GAGGAGAAGTGAAATGGGAGAGG + Intronic
1031371481 7:120972764-120972786 GAGCAAAAGAAAAATGAGAAAGG + Intronic
1031379941 7:121073324-121073346 GAGGAGATGGAAAAAGAGGAGGG + Intronic
1031482749 7:122299118-122299140 GAGAAGGAGAAAAGAGAGGGAGG - Intergenic
1031744197 7:125472743-125472765 GAGGAAAGGGAAAATGAGGTGGG + Intergenic
1031855352 7:126915713-126915735 GGGGAGAAGAGAAATGGTGGCGG + Intronic
1032139563 7:129315171-129315193 GTAGAGAAGAAAAGAGAGGGAGG - Intronic
1032495475 7:132358475-132358497 GTGGAGAAGAAAACGGAAGGAGG + Intronic
1032730188 7:134633785-134633807 GAAGTGAAGAAAAAGTAGGGGGG - Intergenic
1033078194 7:138269177-138269199 GAGAAGAATAAAAATGGGGCTGG + Intergenic
1033551491 7:142451874-142451896 CAGGAGAGAAAACATGAGGGTGG - Intergenic
1033583521 7:142757365-142757387 GAGGAGAAGAGAAAAAAAGGAGG + Intronic
1033613485 7:142988133-142988155 GAGGGAAAGACAATTGAGGGAGG + Intergenic
1033840910 7:145371931-145371953 AAGAAGAAGAAAAATAAGGTGGG - Intergenic
1033841486 7:145379612-145379634 GAGCATAAGAAAAATGATGTTGG - Intergenic
1034075971 7:148231550-148231572 GATGAGAATGAAAAAGAGGGAGG - Intronic
1034087795 7:148335967-148335989 GAAGGGAAGGAGAATGAGGGAGG - Intronic
1034152150 7:148925475-148925497 GAGGAGAGGCAACATGAGGACGG + Intergenic
1034558375 7:151864049-151864071 GAGGAGAGGAGAGAGGAGGGAGG + Intronic
1034697763 7:153069185-153069207 GATGAGAAGAGAAGTGAGTGGGG + Intergenic
1034817252 7:154183137-154183159 GAGGAAGAGAAAAGTGATGGAGG - Intronic
1035419659 7:158717113-158717135 GAGAAGAAGGAAAAAGAAGGAGG - Intergenic
1035419666 7:158717147-158717169 GAGGAGAAGAAGGAAGAAGGAGG - Intergenic
1035419676 7:158717196-158717218 GAGGAGAAGGAAGAAGAAGGAGG - Intergenic
1035419686 7:158717252-158717274 GAGGAGAAGGAAGAAGAAGGAGG - Intergenic
1035419692 7:158717280-158717302 GAGGAGAAGAAGGAAGAAGGAGG - Intergenic
1035419712 7:158717401-158717423 GAGGAGAAGGAAGAAGAAGGAGG - Intergenic
1035419728 7:158717484-158717506 GAGGAGAAGGAAGAAGAAGGAGG - Intergenic
1035419752 7:158717608-158717630 GAGGAGAAGAAGGAAGAAGGAGG - Intergenic
1035419762 7:158717657-158717679 GAGGAGAAGGAAGAAGAAGGAGG - Intergenic
1035419767 7:158717682-158717704 GAGGAGAAGAAGGAAGAAGGAGG - Intergenic
1035419772 7:158717707-158717729 GAGGAGAAGGAAGAAGAAGGAGG - Intergenic
1035516107 8:233065-233087 GAGGAGAAAACAGAGGAGGGAGG + Intronic
1036034983 8:5008859-5008881 GAGTAGAGGAAAAATAAAGGAGG - Intergenic
1036048065 8:5166113-5166135 GAGAGGAAAAAAAATGATGGAGG + Intergenic
1036073522 8:5468981-5469003 GAGGGGAAGAGAATTGCGGGGGG + Intergenic
1036193133 8:6689680-6689702 GAGGAGAAGAGAAATAGGTGTGG - Intergenic
1036546186 8:9771787-9771809 GAGGAGAAGGGAAGTGGGGGAGG + Intronic
1036651603 8:10647485-10647507 GGGGAGAGGAGAAATGAGGATGG - Intronic
1036658135 8:10690823-10690845 GAGGAGGAGAGGAATGAGGAGGG - Intronic
1036813429 8:11883722-11883744 GAGGAGGAGAAGAAATAGGGGGG + Intergenic
1037151248 8:15637828-15637850 GAGAGGAAGAAATAGGAGGGAGG - Intronic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037524428 8:19710914-19710936 GAGGAAAAAAAAAATCAGAGAGG - Intronic
1037802371 8:22042761-22042783 GAGGAGGAGAGAAAAGAGGGAGG - Exonic
1038190786 8:25318483-25318505 GAGGAGAGGAAAAGTGGGGGAGG - Intronic
1038229966 8:25690766-25690788 GAAGAGAAGAAAAAGGAGCTGGG - Intergenic
1038898298 8:31812587-31812609 GAGGAGATAAAAAAGGAAGGAGG - Intronic
1038922490 8:32100081-32100103 GAGGGGAGGAATAAAGAGGGAGG - Intronic
1038942382 8:32319444-32319466 GAGGAGAAGAAGGCTGAGAGAGG + Intronic
1039118293 8:34116852-34116874 GAGGAGAAAGAGAATCAGGGAGG + Intergenic
1039182082 8:34878191-34878213 AAAGAAAAGAAAAAGGAGGGAGG + Intergenic
1039351613 8:36769878-36769900 GAGGAGCAGCCAAATGAGGAGGG - Intergenic
1039390854 8:37179863-37179885 GAGAAGAAGAAAGAAGAGGGAGG - Intergenic
1039393925 8:37206635-37206657 GAGGAAAAGAAAGATAAGTGAGG + Intergenic
1039405391 8:37308283-37308305 GAGGAAGAGAGAGATGAGGGAGG + Intergenic
1039436012 8:37559668-37559690 GAGGAGGAGGAAAAGGAGGAGGG + Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1039439045 8:37581863-37581885 TGGGAAAAGAAAAATAAGGGGGG - Intergenic
1039780472 8:40780028-40780050 GAGGAGAAAAAAAAGTTGGGAGG - Intronic
1040441877 8:47451781-47451803 AAGGAGAAGAGAAGAGAGGGAGG + Intronic
1040453582 8:47573595-47573617 GAGGAGAAGCAAAGTCTGGGAGG + Intronic
1040750061 8:50694404-50694426 GAAGAGAACAATAATGAGTGAGG + Intronic
1041392362 8:57358448-57358470 GAGGAGGAGAGAGAGGAGGGAGG + Intergenic
1041547802 8:59066060-59066082 GAGGAGCATTTAAATGAGGGAGG + Intronic
1041602146 8:59731749-59731771 GGGGAGAAGAAGAGGGAGGGTGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042280437 8:67050295-67050317 TAGGAGAAAAAAAAAGAGGCCGG - Intronic
1042598626 8:70475753-70475775 GAGTGGAAGAAACATGAGCGGGG + Intergenic
1042748301 8:72131537-72131559 AAGGAGAAGAAAAAGGAAGGAGG - Intergenic
1042767283 8:72337337-72337359 GAGGAGAAGGAAAATCAGTGAGG - Intergenic
1042889335 8:73589969-73589991 GGGAAGAAGAAAGAGGAGGGAGG + Intronic
1042893983 8:73645804-73645826 GAGGAAGAGAGAAAGGAGGGAGG + Intronic
1043086172 8:75836170-75836192 TAGTAGAAGAAGACTGAGGGAGG - Intergenic
1043386861 8:79757478-79757500 CGGGAGAAGAGAAAAGAGGGAGG + Intergenic
1043398053 8:79857809-79857831 GAGGAGAAGCAAAAAGGGAGAGG - Intergenic
1043499475 8:80838567-80838589 GAGGAGGAGGAAAAGGGGGGAGG + Intronic
1043534331 8:81185395-81185417 GAGGAGAAGAAAAGGGAAAGTGG + Intergenic
1043873344 8:85459609-85459631 GAGGTAAAGAATAATGAGTGAGG - Intergenic
1044381514 8:91539618-91539640 GGGGAAAAGAGAGATGAGGGAGG - Intergenic
1044536248 8:93359313-93359335 GAAGAAAAAAAAAACGAGGGAGG + Intergenic
1045042920 8:98244200-98244222 GACAAAAAAAAAAATGAGGGGGG + Intronic
1045204194 8:100020178-100020200 AAGGAGAAGAAAATTGCGGCCGG - Intronic
1045478040 8:102569672-102569694 GAGGAGAGGAAAAGAGAGGAGGG - Intergenic
1045755258 8:105534150-105534172 GAGGAAGAGAGAAAGGAGGGAGG - Intronic
1045961568 8:107974704-107974726 GGGGAGAGGAAAAAGCAGGGAGG + Intronic
1046179006 8:110618327-110618349 GAGGAGGAGAAAGAGGAGTGGGG - Intergenic
1046218327 8:111179571-111179593 GAGGAGTAGCCAAATGAGGCTGG + Intergenic
1046339629 8:112836234-112836256 CAGGAGAAGAAAAATGGGTCTGG + Intronic
1046698590 8:117373669-117373691 GAGGAGAAGAGAAAGGGGGAGGG + Intergenic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1047164045 8:122416781-122416803 GAGGAAAAAAAAAATAATGGTGG + Intergenic
1047221538 8:122922608-122922630 GAGGAGAAGGAACAGGAGGAAGG - Intronic
1047511616 8:125520280-125520302 GAGGAGAAGAGAAGAGAGGGAGG + Intergenic
1047570218 8:126089658-126089680 AAGGATAAGAAAAATCAAGGTGG - Intergenic
1047616740 8:126568836-126568858 CAAGAGAAGCAAAAAGAGGGTGG + Intergenic
1047673365 8:127172734-127172756 GAGGAAAAGTAAATGGAGGGTGG + Intergenic
1047688685 8:127328662-127328684 GAGGAGGAGTATAATGAGAGAGG - Intergenic
1047780522 8:128107102-128107124 AAGAAGAAGAAAAAAAAGGGGGG + Intergenic
1048365658 8:133736246-133736268 GAGGGAAAGAAAAAAGAGAGAGG - Intergenic
1048379014 8:133847431-133847453 GAGGAGTTGAAAAAGGAGGTAGG + Intergenic
1049058446 8:140257386-140257408 GAGGAGAAGTAGAAGGAAGGTGG - Intronic
1049121945 8:140747428-140747450 GAGGAGGAGAAGAAAGGGGGGGG + Intronic
1049127334 8:140803923-140803945 GAACAGAAGATAAAGGAGGGAGG + Intronic
1049816676 8:144606347-144606369 GAGGAGAAGGAAGAGGAAGGGGG - Intergenic
1050128393 9:2383473-2383495 CAGGAGCAAGAAAATGAGGGAGG + Intergenic
1050132791 9:2429937-2429959 CAGTAGAAGAAAAATGATCGTGG - Intergenic
1050313841 9:4380964-4380986 AATTAGAAGAAAAATGTGGGAGG + Intergenic
1050350152 9:4733723-4733745 GAGGAGAAATAAGATGAGGCTGG - Intronic
1050867370 9:10519888-10519910 GAGGAGAGGGAAATTGATGGGGG - Intronic
1051133093 9:13884510-13884532 GAGAAAAAGAAAAATGAAGCAGG - Intergenic
1051143454 9:14002859-14002881 GAGGAGAGGAAATATGAGTGAGG + Intergenic
1051189256 9:14493797-14493819 AAGGAGAAGAACAAGGAGGGAGG - Intergenic
1051581784 9:18684039-18684061 GTGGAGGAGAAAAATGAAGAGGG - Intronic
1051661075 9:19427628-19427650 GAAGAGAAAAGAAAGGAGGGGGG - Intronic
1052037200 9:23696121-23696143 GAGGAGAAGAAAGATTAGAGTGG - Intronic
1052200791 9:25777119-25777141 AATGAGAAGAAAAATGAAAGTGG + Intergenic
1052323911 9:27196726-27196748 CAGGAGCAGAAGAGTGAGGGGGG + Intronic
1052500643 9:29285195-29285217 GAGGAGGAGAAAGAAGAGGAGGG + Intergenic
1052520462 9:29541487-29541509 GAGAAGGAGAAAAGGGAGGGAGG - Intergenic
1052538767 9:29779813-29779835 GAGGAAAAGGAAGATGAGCGTGG - Intergenic
1052902252 9:33803212-33803234 GAGGAGAAGAGAAACAAAGGGGG + Intergenic
1053116222 9:35505382-35505404 GAGGAGTAGAAATATGTGGTGGG - Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053193740 9:36098040-36098062 GAGGAGGAGAGAGAAGAGGGAGG + Intronic
1053222978 9:36327009-36327031 GGGGAGAAGACAGAGGAGGGAGG + Intergenic
1053306531 9:36988019-36988041 GAGAAGATGAAGAAGGAGGGAGG + Intronic
1053540472 9:38968595-38968617 GAAGAAAAGAAAAAAGGGGGAGG - Intergenic
1053666345 9:40320475-40320497 GTGGGGGTGAAAAATGAGGGGGG + Intronic
1053915928 9:42945522-42945544 GTGGGGGTGAAAAATGAGGGGGG + Intergenic
1054377498 9:64460503-64460525 GTGGGGGTGAAAAATGAGGGGGG + Intergenic
1054518264 9:66055808-66055830 GTGGGGGTGAAAAATGAGGGGGG - Intergenic
1054625668 9:67395328-67395350 GAAGAAAAGAAAAAAGGGGGAGG + Intergenic
1055617051 9:78083749-78083771 GAGGACAAGCCAAAGGAGGGCGG + Intergenic
1055708252 9:79031885-79031907 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1055863212 9:80779971-80779993 AAAAAGAAGAAAAATGTGGGAGG - Intergenic
1056290484 9:85138509-85138531 CAGGAGAAGAGAAATGAAAGGGG + Intergenic
1056545145 9:87606777-87606799 GGGAAGGAGAAAAAGGAGGGAGG - Intronic
1056558472 9:87709460-87709482 TAGTAGAAGAAAGGTGAGGGAGG + Intergenic
1056710700 9:88990502-88990524 GAGGAGGAGGAAAAGGAGAGAGG - Intergenic
1056832869 9:89930903-89930925 GAGAAGAAGGGACATGAGGGAGG + Intergenic
1056959624 9:91111585-91111607 GAGGAGAAGGAAAGAGATGGGGG + Intergenic
1057258452 9:93569354-93569376 AAGTAGAATAAAACTGAGGGAGG - Intergenic
1057395811 9:94679019-94679041 TGGGAAAACAAAAATGAGGGAGG + Intergenic
1057744792 9:97742247-97742269 GAAGAGAAGAAGAAAGAAGGCGG + Intergenic
1057925128 9:99139818-99139840 GAGGAGAAAAAAGATGAAGGGGG - Intronic
1058170572 9:101675991-101676013 TAAGACAAGAAAAATCAGGGGGG - Intronic
1058278406 9:103077609-103077631 GAGGAGGAAAAAAATGGGGTTGG + Intergenic
1058292207 9:103256797-103256819 GTGCAGAAGAAAAATGTGGTTGG - Intergenic
1058293867 9:103280197-103280219 GAGAAAAAAAAAAAAGAGGGAGG + Intergenic
1058425450 9:104871682-104871704 GAGAGGCAGAAAAATGAGAGAGG + Intronic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058767762 9:108198498-108198520 GAGGAGAGGAAAGAATAGGGAGG + Intergenic
1058920628 9:109611280-109611302 GAGCAGAAGAGAAAAAAGGGAGG - Intergenic
1059229799 9:112709172-112709194 GAAGAAAAGAAAAATAAGTGGGG - Intronic
1059431532 9:114253414-114253436 GAAGAGGAGAAAAAAGAGGAGGG + Intronic
1059431533 9:114253417-114253439 GAGGAGAAAAAAGAGGAGGGAGG + Intronic
1059510948 9:114846172-114846194 GATAAGAAGAAAAGTAAGGGGGG + Intergenic
1059568112 9:115404097-115404119 AAGGAGAAGAAAAAGAAGAGGGG - Intergenic
1059629568 9:116106241-116106263 GGAGAGAAGAAAAGTGAGTGAGG + Intergenic
1059868265 9:118541689-118541711 AAAGAAAAGAAAAATGAAGGAGG - Intergenic
1060381534 9:123179022-123179044 GAAGTGAAGAAAGATGAGGCCGG - Exonic
1060446166 9:123690104-123690126 GGGAGGAAGAAAAAGGAGGGAGG + Intronic
1060700743 9:125747356-125747378 GAGGAGAAGAAAGAGGGGGAGGG - Intronic
1060705204 9:125792371-125792393 GAGGTGAAGGAAAATGAGAATGG + Intronic
1060735733 9:126065549-126065571 GAGGAGGAGGGAAAGGAGGGAGG - Intergenic
1061282020 9:129602885-129602907 GAGGAGGGGGAGAATGAGGGAGG + Intergenic
1061994631 9:134177299-134177321 GAGGAGGAGAGACATGATGGGGG - Intergenic
1062480954 9:136751086-136751108 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1203770113 EBV:45548-45570 GAGGGTAAGAAAAGTGGGGGTGG + Intergenic
1203465252 Un_GL000220v1:80034-80056 GATGAGAAGAAAAAAGATAGAGG + Intergenic
1185501747 X:602075-602097 GAGAAGAAGAAAAAGGAAGGAGG - Intergenic
1185502515 X:608482-608504 GAAGAGAAGAAAAAGGAGAGAGG - Intergenic
1185662009 X:1735515-1735537 GAGGAGGAGAAAGAGGAGGAGGG - Intergenic
1185717788 X:2356667-2356689 GAGGAGAAGGAGGAAGAGGGAGG - Intronic
1186034468 X:5406127-5406149 GAGGAGGAGGAAGATGAAGGAGG + Intergenic
1186222023 X:7359413-7359435 GAGGAAAGGAAAAATGAGAATGG + Intergenic
1186264577 X:7818598-7818620 GAGGAGGAGAAAAGGAAGGGAGG + Intergenic
1186291138 X:8100241-8100263 GAGAAGAGAGAAAATGAGGGAGG + Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186393383 X:9183201-9183223 GTGAAGGAGAAAAATGGGGGTGG - Intergenic
1186576759 X:10775088-10775110 GAGGAGAATGAAAAAGAGGGAGG + Intronic
1186590120 X:10921408-10921430 GAGGAGAAATAAAAGGAGGGAGG - Intergenic
1186788035 X:12971585-12971607 GAGAAGAAGGAAGAGGAGGGAGG - Intergenic
1186795141 X:13039833-13039855 GATGAGCAGAAAGATGAGGAAGG - Exonic
1187025826 X:15434366-15434388 GAGGAGGAGAAAAAAGAAGGAGG + Intronic
1187071350 X:15892017-15892039 GAGGAAAAGAGAGATGGGGGAGG + Intergenic
1187163971 X:16787359-16787381 GAGGGGAAAAAAGAGGAGGGTGG - Intronic
1187196751 X:17093660-17093682 GAGGAGAAAGATAATGGGGGAGG - Intronic
1187521258 X:20016206-20016228 GAGGAAAAGAAAAAACAGGAAGG - Exonic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1188276277 X:28205566-28205588 AATGAGAGGGAAAATGAGGGAGG - Intergenic
1188480264 X:30630183-30630205 GTGGAGAGGAAATAGGAGGGCGG - Intergenic
1188660948 X:32757953-32757975 GAGGAGGAGGAAGAGGAGGGAGG + Intronic
1188980183 X:36720428-36720450 GAGAAGAAGAAGAAGAAGGGAGG + Intergenic
1189019548 X:37320100-37320122 GAGGAGAAGAAAAGGAAGAGGGG + Intergenic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189156489 X:38762463-38762485 GAGGAGGAGAAAGAGGAGGAAGG + Intergenic
1189229691 X:39442637-39442659 GAGGTGAAGGAAAATGAAGCAGG - Intergenic
1189292496 X:39896087-39896109 GAGGAGAACAGATATAAGGGGGG + Intergenic
1189382997 X:40515178-40515200 GAGGAAGAGAAAAAAGGGGGAGG + Intergenic
1189646243 X:43135792-43135814 GAGGAACAGAGAAAGGAGGGAGG - Intergenic
1189923667 X:45930455-45930477 GAGGACAAAAAAAATTGGGGTGG + Intergenic
1189937234 X:46082256-46082278 GAGGAAAAGAAAAAAGAATGGGG + Intergenic
1190053818 X:47170675-47170697 GAGGAGAGGAAAATCAAGGGTGG + Intronic
1190058120 X:47193938-47193960 GAGGAGGAGAAGGAGGAGGGTGG + Exonic
1190260396 X:48793533-48793555 GAGGAGAGGAAGGAGGAGGGCGG - Intronic
1190718797 X:53129383-53129405 AAGAAGAAGAAAAATCAGGCTGG - Intergenic
1190795036 X:53733053-53733075 GAGGAGGAGGAAGAAGAGGGGGG - Intergenic
1190915796 X:54810232-54810254 GAGGAGTAGAAAACCAAGGGTGG - Intronic
1191871149 X:65746688-65746710 GAGGTGAGGAAGATTGAGGGAGG - Intergenic
1192204149 X:69085183-69085205 GAGGAGGAGAAGAAAGAGGAGGG - Intergenic
1192320883 X:70089602-70089624 GAGGAGAAGAAAAGAGGGAGAGG - Intergenic
1192379164 X:70597330-70597352 AAAAAGAAGAACAATGAGGGGGG + Intronic
1192639091 X:72846163-72846185 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1192642620 X:72874642-72874664 GAGGAGGAGAAGAAGGAGGAGGG - Intronic
1192678724 X:73228986-73229008 AAAAAGAAGAAAAATGATGGAGG - Intergenic
1192679886 X:73241628-73241650 GGGGAGAAGAAGAATGACTGGGG + Intergenic
1193083890 X:77431011-77431033 GAAGAGAAGAGAAGTGAGGCAGG - Intergenic
1193221403 X:78930611-78930633 GAGGAGAGAGAAAATGAGGAGGG - Intergenic
1193499601 X:82259110-82259132 GAGGAGAATAAAAAAGTCGGGGG - Intergenic
1193594001 X:83423343-83423365 GAGGAAGAAAAAAATGAGGTTGG + Intergenic
1193601701 X:83514390-83514412 GAGGAGAAGAAAGAGGAGAATGG + Intergenic
1194085076 X:89516380-89516402 AAGGAAAACAAAAATTAGGGAGG - Intergenic
1194113733 X:89871139-89871161 GAGAAGAAGAAAAATTAGGCAGG - Intergenic
1194193411 X:90864786-90864808 GAGAACAAGAAAAAGCAGGGTGG + Intergenic
1194218961 X:91167911-91167933 GAGGAGAAGAAAGAATGGGGAGG - Intergenic
1194267367 X:91771462-91771484 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1194638915 X:96378514-96378536 AAGGAGAAACAAAAGGAGGGTGG + Intergenic
1194676205 X:96796726-96796748 GAGAAGAATAAAAAAGATGGGGG - Intronic
1194767221 X:97855778-97855800 GATGTGAAGAAAAAGGAAGGGGG - Intergenic
1194925146 X:99815730-99815752 GAAGATAAGAAAAAAGAGAGGGG + Intergenic
1195233860 X:102877872-102877894 GAGCAGGAGACAAATGAGGTGGG + Intergenic
1195235815 X:102897227-102897249 AAGGAGAAGAAGGATAAGGGAGG + Intergenic
1195315839 X:103676919-103676941 GCAGAGAAGTAAAATGAGAGGGG - Exonic
1195412064 X:104578211-104578233 GAGAAGCAAAAAGATGAGGGTGG + Intronic
1195570875 X:106397432-106397454 GAGCAAAAGAGAGATGAGGGAGG - Intergenic
1195697405 X:107677053-107677075 GGGGAGGAGAAAAAAGTGGGCGG + Intergenic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196534542 X:116827408-116827430 GAGAAAGAGAGAAATGAGGGAGG + Intergenic
1196600301 X:117594050-117594072 GAGAAAAAGAACAAAGAGGGAGG + Intergenic
1196690864 X:118556976-118556998 GAGGAGGAGAAAGAAGAGTGTGG + Intronic
1196762508 X:119212191-119212213 GAGGCCAAGAAAAAAGAGGTAGG + Intergenic
1196918156 X:120560765-120560787 GACGAGAAGGAAAGTGAAGGGGG + Intronic
1197140433 X:123111826-123111848 GAAGAGAAGAATAATGATGAGGG - Intergenic
1197176498 X:123491767-123491789 AAGAAGAAGAAAAATGGGAGTGG + Intergenic
1197527782 X:127583378-127583400 GAGGAGAGGAAAAAGTGGGGAGG - Intergenic
1197980373 X:132211927-132211949 GAAGAGAAGAAAATAGATGGTGG - Intronic
1198184709 X:134242233-134242255 GAAGAGAGGAAAAGTGAAGGGGG - Intronic
1198237303 X:134747345-134747367 GAAGAGAAGATAAATGAGGAGGG + Intronic
1198444826 X:136702001-136702023 AAGAATAAGAAAAATGAGGCCGG - Intronic
1198533496 X:137566478-137566500 GAGGGGAAGAAAGAGCAGGGAGG - Exonic
1198631261 X:138641318-138641340 GAGGAGAAGAAGAGAGAGGTGGG - Intronic
1198674362 X:139116665-139116687 GAAGAAAAGAAAAAGGAGAGCGG + Intronic
1198739435 X:139825188-139825210 GGAGAGAAAAAAAATGAGGAAGG + Intronic
1198791355 X:140350188-140350210 GTAGAGAAGAAAAATGAAGCAGG - Intergenic
1199250911 X:145660416-145660438 GAGGAAGAGAAAAAGGCGGGAGG - Intergenic
1199751550 X:150824134-150824156 GAGGAGGAGAAGAAGGAAGGAGG + Intronic
1199996669 X:153030481-153030503 GAGGAGTTGGAAAATGAGGATGG + Intergenic
1200437724 Y:3172264-3172286 AAGGAAAACAAAAATTAGGGAGG - Intergenic
1200466411 Y:3526177-3526199 GAGAAGAAGAAAAATTAGGCAGG - Intergenic
1200540022 Y:4447173-4447195 GAGAACAAGAAAAAGCAGGGTGG + Intergenic
1200555473 Y:4631667-4631689 GAGGAGAAGAAAGAATGGGGAGG - Intergenic
1200584572 Y:4992399-4992421 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1201247911 Y:12024662-12024684 GAGGAGGAGTAAAAAGAGGAGGG - Intergenic
1201271077 Y:12254134-12254156 GAAGAGAAGGAAAAGGTGGGAGG + Intergenic
1201348694 Y:13014839-13014861 GAGCAGACCAAAAATGAGGAAGG - Intergenic
1201590384 Y:15608521-15608543 GAAGAAAGGAAAAATGAGGATGG + Intergenic
1201942440 Y:19474326-19474348 GAGGAGAAGGGAAAGGAGTGTGG + Intergenic