ID: 956953524

View in Genome Browser
Species Human (GRCh38)
Location 3:74310556-74310578
Sequence AACCCTATGCAGCTGTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 2, 2: 7, 3: 12, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956953524_956953530 29 Left 956953524 3:74310556-74310578 CCTGTCCACAGCTGCATAGGGTT 0: 1
1: 2
2: 7
3: 12
4: 87
Right 956953530 3:74310608-74310630 GTAATTGTGCTAGTGGAACAAGG 0: 1
1: 0
2: 1
3: 6
4: 78
956953524_956953528 22 Left 956953524 3:74310556-74310578 CCTGTCCACAGCTGCATAGGGTT 0: 1
1: 2
2: 7
3: 12
4: 87
Right 956953528 3:74310601-74310623 ACCAAGAGTAATTGTGCTAGTGG 0: 1
1: 0
2: 0
3: 9
4: 85
956953524_956953526 -7 Left 956953524 3:74310556-74310578 CCTGTCCACAGCTGCATAGGGTT 0: 1
1: 2
2: 7
3: 12
4: 87
Right 956953526 3:74310572-74310594 TAGGGTTCTTAATACTATAGTGG 0: 1
1: 0
2: 0
3: 4
4: 66
956953524_956953527 -3 Left 956953524 3:74310556-74310578 CCTGTCCACAGCTGCATAGGGTT 0: 1
1: 2
2: 7
3: 12
4: 87
Right 956953527 3:74310576-74310598 GTTCTTAATACTATAGTGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956953524 Original CRISPR AACCCTATGCAGCTGTGGAC AGG (reversed) Intronic
902169932 1:14601521-14601543 AACCCTCTGCAGAGGTGGTCTGG + Intronic
902940234 1:19795877-19795899 AGCCCCAGGCACCTGTGGACGGG + Intronic
910492981 1:87793693-87793715 AAGCATATACAGCTGTGGACAGG - Intergenic
910874337 1:91864206-91864228 GACCCACTGCAGCTGTGGGCAGG - Intronic
912263808 1:108134172-108134194 TGCCTTGTGCAGCTGTGGACAGG + Exonic
916155205 1:161838601-161838623 AAACCCATGCAGCTGTGGAGAGG - Intronic
917345145 1:174022011-174022033 AACAATAGGCAGCTGTGGTCGGG - Intronic
922188117 1:223294176-223294198 AACTCTATGTAGATGGGGACTGG + Intronic
923505736 1:234605013-234605035 AAGTCTATCCAGCTGTGGAAAGG - Exonic
1063077217 10:2729390-2729412 AAACCTAGGCAGCTGTAGCCAGG + Intergenic
1066202192 10:33152526-33152548 ATCCCTCTGCAGCTGTGGGATGG - Intergenic
1073384368 10:103111072-103111094 GAGCCTTTGCAGCTGTGGAGAGG - Intronic
1073594724 10:104788332-104788354 AATACTATGCAGCTGTGAAGAGG + Intronic
1074791922 10:116897840-116897862 CACCCTGTGCATATGTGGACAGG + Intronic
1076667632 10:132102207-132102229 AACCCTAGGCAGCTTGGGAAAGG - Intergenic
1078060607 11:8040349-8040371 GACACTCTGCAGCTGGGGACAGG - Intronic
1079531094 11:21454721-21454743 AACCCGCTGCAGCTGAGGAATGG - Intronic
1080486972 11:32718713-32718735 AACCCTCTGCAGCTGGGCAAGGG + Intronic
1081530301 11:43953988-43954010 ATCCCAATACAGCTGTGGACAGG - Intergenic
1081812118 11:45920036-45920058 CTCCCTCTGCAGCTGTGGAGAGG + Intergenic
1088554957 11:111052411-111052433 AACCCTTGGCAGCTGCGGTCAGG - Intergenic
1092461106 12:8686844-8686866 AATCCTATGCAGATTTGGAGAGG + Intronic
1098097627 12:66976058-66976080 AAGCCTATGCAACTGGGGAAGGG - Intergenic
1098917931 12:76276387-76276409 ACTCTTATGCAGCTGTGGATGGG - Intergenic
1103089024 12:118084259-118084281 AACCTTTTGCAGCTCTTGACTGG - Intronic
1103737998 12:123072667-123072689 AACCTTGAGCAGCTGTTGACAGG - Intronic
1105387868 13:19948763-19948785 AAGGCTATGCAGGTGTGGAATGG + Intergenic
1109611548 13:64771661-64771683 AACACTATGCAGCTGTAAAATGG - Intergenic
1112889320 13:104211550-104211572 AACCCCTTGCAGCTGTGGTTTGG + Intergenic
1115420394 14:33187256-33187278 AAGCCAATACAGCTGTGGAATGG - Intronic
1122352157 14:101102634-101102656 AATCCTATGTGGCTGTTGACTGG + Intergenic
1125172606 15:36783097-36783119 AACTGTATGCAGCTGCTGACAGG - Intronic
1125535159 15:40438225-40438247 AGCCCTTTCCAGCTGTGGAAGGG + Intergenic
1126477313 15:49079496-49079518 AACCCTTTGCATCTGTGGCCAGG + Intergenic
1130752610 15:86728410-86728432 AAGCCTGGGCAGTTGTGGACAGG - Intronic
1132773850 16:1580950-1580972 ACCCCTATGAAGCTGTGGTGAGG - Intronic
1133024530 16:2982216-2982238 AGCCCTAGGCAGCTGGGGAGGGG - Intergenic
1139205815 16:65027354-65027376 AAGCCTATGCAGCTGGAGATGGG + Intronic
1140884343 16:79229593-79229615 AACTCCATCCATCTGTGGACAGG + Intergenic
1141262379 16:82465705-82465727 AACCCTATGCAGCTTTTCCCTGG + Intergenic
1142795707 17:2304963-2304985 AAGCCTATGGGGCTGTGGAGGGG - Intronic
1147155353 17:38542037-38542059 AGCCCTATGCAGGTGTGGGGGGG + Intronic
1149545885 17:57503701-57503723 AACCATAAGCACCTGTGAACAGG - Intronic
1152642227 17:81454067-81454089 ATCCCTTTGCACCTGTGGGCAGG + Intronic
1153092773 18:1367230-1367252 AACTTTATGCAGCAGTTGACTGG + Intergenic
1153223344 18:2880503-2880525 TACCCAAGGCACCTGTGGACGGG + Intronic
1155623944 18:27813106-27813128 AACCCTGCGCACCTGTGCACCGG - Intergenic
1159860720 18:73646090-73646112 CATCATATGCAGCTGTGGATGGG - Intergenic
1160359438 18:78259117-78259139 TACCCTATGCAGCTGTGGACGGG + Intergenic
1160697886 19:493472-493494 CTCCCTCGGCAGCTGTGGACAGG + Intronic
1161565780 19:5001423-5001445 AACACTACGCAGCTGTGCAGGGG - Intronic
1163117572 19:15197663-15197685 ATCCCCATGCAGCTGTTGCCTGG - Intronic
1163890410 19:20007713-20007735 ATCCCTATACATCTGTGAACTGG + Intronic
1164029493 19:21389522-21389544 CACCCTATGCAGCAGTGAAATGG - Intergenic
1165862431 19:38916195-38916217 AGCCCTGTGCCGCTGGGGACGGG - Intronic
1166164530 19:40977966-40977988 AACCAAATGCAGCTGTGGGATGG - Intergenic
930584718 2:53255647-53255669 GACCGTATGAAGCTGTGGAAGGG - Intergenic
930706637 2:54510953-54510975 AAGCCCATGCAGCTTTGGACAGG + Intronic
933244255 2:79957486-79957508 AAACCAAAGCAGCTGTAGACAGG - Intronic
934538659 2:95157618-95157640 AGCCTCATGCAGCTGTGTACAGG - Intronic
939098496 2:137865361-137865383 AACTCTCTGGAGCAGTGGACTGG + Intergenic
1170556875 20:17521926-17521948 AACCCTCAGTTGCTGTGGACTGG - Intronic
1173360524 20:42340380-42340402 AACCCTAAGCAGCTGTAGCCAGG + Intronic
1177452991 21:21296283-21296305 AACCCAATGCAGCTGAAGACAGG + Intronic
1184445899 22:44546712-44546734 AGTCCTATGGAGCTGTTGACAGG - Intergenic
1185233625 22:49698850-49698872 AACCCCATGCGGCCGTGGACAGG + Intergenic
1185233634 22:49698877-49698899 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233642 22:49698904-49698926 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233650 22:49698931-49698953 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233658 22:49698958-49698980 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233666 22:49698985-49699007 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233674 22:49699012-49699034 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233682 22:49699039-49699061 AACCCCAGGCAGCTGTGGAGAGG + Intergenic
1185233920 22:49700118-49700140 AACCCTAGGCAGCTGTGGACAGG + Intergenic
1185233927 22:49700145-49700167 AACCCCAGGCAGCTGTGGACAGG + Intergenic
956953524 3:74310556-74310578 AACCCTATGCAGCTGTGGACAGG - Intronic
961629136 3:128283515-128283537 AACCCTAGGCAGCTCCAGACTGG + Intronic
968149216 3:196323931-196323953 AGCCCTCTGCAGCTGTTGTCTGG - Exonic
970184293 4:13433043-13433065 AACCTTATGCTGCTGTGAAGAGG + Intronic
972877233 4:43377682-43377704 AATACTATGCAGCTGTGAAAGGG + Intergenic
973735013 4:53863319-53863341 AACAAAATACAGCTGTGGACCGG + Intronic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
980192975 4:129548595-129548617 AACTCTTTGCAGCTGTGGAAAGG - Intergenic
982086687 4:151842805-151842827 GTCCCTCTGCAGCTGTGGAGAGG + Intergenic
983497327 4:168458459-168458481 AATACTATGCAGCTGTGAAAAGG + Intronic
983622406 4:169774819-169774841 CATCCTATCCTGCTGTGGACCGG + Intergenic
985550806 5:532681-532703 AAGCCTCTGGAGCTGTGGAATGG + Intergenic
988966109 5:36419615-36419637 AACCCTATGCAGCCATGGGGAGG + Intergenic
994923540 5:106083696-106083718 AAACCTATGCAGGTGTGAAGTGG - Intergenic
1012333145 6:98018868-98018890 ATCCCTATGCAGATGAGTACTGG + Intergenic
1013418063 6:109942166-109942188 ATCCATAAGCAGATGTGGACAGG - Intergenic
1017006289 6:150029872-150029894 CACCCTATGCACCTGAAGACTGG - Intergenic
1026086581 7:67268011-67268033 ACCCCCATGTAGCTGTGGGCAGG - Intergenic
1026215180 7:68342225-68342247 TTCCCTATGCATATGTGGACAGG - Intergenic
1032405289 7:131651431-131651453 AACTTGATGCAGCTGTGGAAAGG - Intergenic
1032504198 7:132423659-132423681 AACCCTGTGCTGTTGTGGAAGGG - Intronic
1032801175 7:135318246-135318268 AAGCCTTAGCAGCTGTGGCCAGG - Intergenic
1035426869 7:158783928-158783950 AACCCACTGCAGCTGGGGAGAGG + Intronic
1036544298 8:9751445-9751467 AACTCTTTGGAGCTGTGGATAGG + Intronic
1041799764 8:61786400-61786422 AACCCTATGTAGCAGTGGCCAGG + Intergenic
1044503739 8:92992321-92992343 AACCCTCTGCCTCTGAGGACAGG + Intronic
1044861349 8:96526771-96526793 ACCCCTGTGTAGCTGTGGCCAGG + Intronic
1047542437 8:125783293-125783315 TACCCTATGCATGTGTAGACTGG + Intergenic
1055955368 9:81768368-81768390 AACCTTTTTCAGCTGTGGTCAGG - Intergenic
1185452668 X:291032-291054 AGCCACATGCAGATGTGGACAGG + Intronic
1188558956 X:31445775-31445797 AACCCTATGCAGATATGGGGAGG + Intronic
1196060073 X:111398674-111398696 AACCCTATGCATCACTGGACTGG + Intronic