ID: 956958617

View in Genome Browser
Species Human (GRCh38)
Location 3:74371847-74371869
Sequence ATGGGGCTTCTCCGAGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956958617_956958624 19 Left 956958617 3:74371847-74371869 CCTTAGCCTCGGAGAAGCCCCAT 0: 1
1: 0
2: 0
3: 8
4: 116
Right 956958624 3:74371889-74371911 TCTTTTGCACGTGCTGCTTCTGG 0: 1
1: 1
2: 1
3: 12
4: 144
956958617_956958626 21 Left 956958617 3:74371847-74371869 CCTTAGCCTCGGAGAAGCCCCAT 0: 1
1: 0
2: 0
3: 8
4: 116
Right 956958626 3:74371891-74371913 TTTTGCACGTGCTGCTTCTGGGG 0: 1
1: 0
2: 2
3: 13
4: 167
956958617_956958625 20 Left 956958617 3:74371847-74371869 CCTTAGCCTCGGAGAAGCCCCAT 0: 1
1: 0
2: 0
3: 8
4: 116
Right 956958625 3:74371890-74371912 CTTTTGCACGTGCTGCTTCTGGG 0: 1
1: 1
2: 2
3: 19
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956958617 Original CRISPR ATGGGGCTTCTCCGAGGCTA AGG (reversed) Intronic
900583220 1:3419453-3419475 ATGGGGCATCTCTGAGCCTCGGG - Intronic
901195431 1:7437402-7437424 ATGAGGCTTCTCCCAGCCCAGGG - Intronic
902519478 1:17007916-17007938 ATGGGGCTGCTCAGAGGCTGGGG - Intronic
903647037 1:24902040-24902062 ATGGGCCGGCTCCGAGGCTCCGG - Exonic
904128424 1:28259016-28259038 TTGGAGCTTCCCCGAGGCCAGGG + Intergenic
906140497 1:43531245-43531267 GGGGGGCTTCGCCGAGGCTGCGG - Intronic
914885574 1:151581741-151581763 AGTGGGCTTCTCCGAGGCAGAGG - Exonic
916552012 1:165858662-165858684 ATGGGGCCTCTCCTGGGCTAAGG - Intronic
923381528 1:233424773-233424795 ATGGGGGTTGCCAGAGGCTAAGG - Intergenic
1063379022 10:5572639-5572661 ATGCGGCTCCTCCAAGCCTAGGG - Intergenic
1067587571 10:47485008-47485030 ATGGGGCAGCTCCGGGGCTGGGG - Intergenic
1067634626 10:47992774-47992796 ATGGGGCGGCTCCGGGGCTGGGG - Intergenic
1069872706 10:71542899-71542921 AGGGGGCTTCTGTGAGCCTAGGG + Intronic
1072791602 10:98321924-98321946 GTGGTGCTTCTCAGAGGCTCAGG + Intergenic
1074306129 10:112280247-112280269 ATGGGGCTTCTCATTGCCTATGG - Intergenic
1084627124 11:70316631-70316653 ATGGGGCTACTTCGAGGCATTGG + Intronic
1086201156 11:84203763-84203785 ATGGGGCTTGTCAGAGGGTGTGG + Intronic
1091372655 11:135073825-135073847 CTGGGGCTTCTCAGAGGCAAGGG - Intergenic
1093422104 12:18985855-18985877 ATGGGGGTTATCAGAGGCTGTGG + Intergenic
1095555333 12:43496525-43496547 CTAGGGCTTCTCTGAGGCCACGG - Intronic
1099605109 12:84794490-84794512 ATGGGGCTTCTCCAAAGCGATGG + Intergenic
1101351181 12:103930818-103930840 GTGGGGCCTCTCTGAGGCTCTGG + Intronic
1104950560 12:132437956-132437978 ATGGGGGTTCTCTGAAGCTCAGG + Intergenic
1109688926 13:65860503-65860525 TGGGGGCTTATCCGAGGCTCAGG + Intergenic
1117387117 14:55226708-55226730 ATAGGGCTTTTCCCAGGCCAGGG + Intergenic
1118911131 14:70063054-70063076 ATGGGGCTTCTCAGAGTGGATGG - Intronic
1120907128 14:89630459-89630481 AGGGGGCTTCACCGAGGCAAAGG - Intronic
1124673376 15:31660920-31660942 ATGTGCCTTCTCCGAGCCTCAGG - Intronic
1125513778 15:40306900-40306922 ACGGGGCTGCTCCCAGGCTCTGG - Intronic
1128466273 15:67915149-67915171 GTGGGGCTTCTGAGAGGCTGGGG - Intergenic
1129224503 15:74160437-74160459 ATGGGGCCTGTCAGAGGGTAGGG - Intergenic
1130299305 15:82667779-82667801 AAGGGGCTTTTCCCAGGCCAAGG + Intronic
1131406345 15:92168069-92168091 ATGGGGGTTCTTGGAGGGTAGGG - Intronic
1131839481 15:96420739-96420761 ATGTGGTTTATCCGAGGCTCAGG - Intergenic
1137359671 16:47802354-47802376 ATGGGGCCTGTCGGAGGCTGGGG + Intergenic
1142179844 16:88663060-88663082 CAGCGGCTTCTCCGAGGCCATGG + Exonic
1144638842 17:16926728-16926750 ATGGGGATTCTCCAAGGGTTCGG - Intergenic
1146237345 17:31179589-31179611 ATGGGGTTTCACTGAGGCCAAGG - Intronic
1146577338 17:34006171-34006193 AAGAGGCTTCTCTGAGGCGATGG + Intronic
1148683910 17:49490169-49490191 ATGGGGCTCCTTCCAGGATAGGG + Intergenic
1150603772 17:66674254-66674276 ATGGGTCTTGTGCAAGGCTAAGG + Intronic
1151858894 17:76743960-76743982 AAGGGGCTTCTCAGGGTCTAAGG + Intronic
1152007099 17:77689184-77689206 ATGGGGCTTCTGAGAGCATAAGG + Intergenic
1152646823 17:81473037-81473059 ATGAGGCTTCGCAGAGGCCATGG - Intergenic
1158014255 18:52765539-52765561 ATGGAGCCTCTCCTAGTCTAGGG - Intronic
1159886710 18:73914529-73914551 ATGGGGCGTTTCGGAGGTTAAGG - Intergenic
1161743078 19:6036444-6036466 ATGGGGCCTCTCTGATGCCAGGG + Intronic
1165256485 19:34579641-34579663 CTGGGGCTTCTTAGAGGCCAGGG + Intergenic
1165272861 19:34725326-34725348 AAGGGGCTTGTCCCAGGCTTGGG - Intergenic
1167119785 19:47509928-47509950 ATGGGGCTACTGAGAGGCAAGGG - Intronic
932077021 2:68674079-68674101 CTGGGGCTTTACCGAGGCTGGGG - Intergenic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
932713914 2:74087946-74087968 AGAGGGTGTCTCCGAGGCTACGG - Exonic
937477426 2:122227861-122227883 ATGGGGGTTCACAGAGGCTCTGG - Intergenic
937574450 2:123402651-123402673 ATGGTGGTTGTCAGAGGCTAGGG + Intergenic
940059729 2:149551456-149551478 ATGGTGATTCCCAGAGGCTACGG - Intergenic
940899036 2:159109326-159109348 ATGGGGCTTCTAAGATGTTATGG + Intronic
941207918 2:162597512-162597534 ATGGTGCTTATCAGAGGCTGGGG + Intronic
941923013 2:170870560-170870582 GTGGGGCTGGTTCGAGGCTATGG - Intergenic
1170337386 20:15284785-15284807 ATGGGGCTTAACCTAGGCAAGGG - Intronic
1171511072 20:25685490-25685512 AGGAGGCTTCTCTGAGGCCAGGG - Intronic
1172947763 20:38702121-38702143 ATGGGGCCTTTCAAAGGCTATGG - Intergenic
1173106930 20:40145581-40145603 ATGGGGGTTCTCAGGGGCTGGGG - Intergenic
1173220754 20:41131035-41131057 ATGGGGTTTCACCGTGGCCAGGG - Intergenic
1173523036 20:43712996-43713018 ATGGGGCTCCGCCGCAGCTAGGG - Exonic
1175627324 20:60500361-60500383 ATGGGGATTCACTGAGGTTATGG + Intergenic
1175960215 20:62632111-62632133 ATGGGGGTTGTCAGAGGCTGGGG - Intergenic
1176056764 20:63152962-63152984 ATGGGTCTTCTCCCAGGCGGTGG - Intergenic
1179043305 21:37823807-37823829 ATGGTGGTTCCCAGAGGCTAAGG + Intronic
1179484956 21:41704192-41704214 GTGGGGCTTCCTCGAGGCCAAGG - Intergenic
1184620263 22:45671697-45671719 ACGGGGCTCCTCCGAGGGGAGGG - Intergenic
954872562 3:53778811-53778833 ATGTGGCTTCTCCCAGGCTTTGG - Intronic
954983264 3:54765417-54765439 AAAAGGCTTCTCCGATGCTAGGG + Intronic
956732820 3:72212372-72212394 AAAGGGCTTCTCAGAGGCTAGGG + Intergenic
956958617 3:74371847-74371869 ATGGGGCTTCTCCGAGGCTAAGG - Intronic
957192143 3:77022960-77022982 ATGGTGGTTGTCAGAGGCTAAGG - Intronic
959483095 3:106897280-106897302 AAGGGACTTCTAAGAGGCTAGGG + Intergenic
959974012 3:112437643-112437665 AGGGGGCTTCTCCAAGGCCCTGG + Intergenic
967495017 3:190133571-190133593 CTGTGGCTTTTCCGAAGCTAAGG - Intergenic
970053036 4:11937932-11937954 ATGGTGATTATCAGAGGCTAGGG + Intergenic
972675686 4:41257486-41257508 CTGGGGCTCCTCCCAGGCTCGGG + Intronic
972706343 4:41547325-41547347 ATGGGGGTTACCGGAGGCTAAGG - Intronic
977490595 4:97705216-97705238 ATGGGGCTTTTTCTAGGCAAAGG - Intronic
977953714 4:103002720-103002742 ATAGGGCTGCTCAGAGGCAATGG - Intronic
982537114 4:156620587-156620609 ATGGGGCTTCACTGAGAATATGG + Intergenic
983178734 4:164622869-164622891 AGGGAGCTTCTAGGAGGCTATGG + Intergenic
986544975 5:8886486-8886508 GTGGGGCCTGTCAGAGGCTAGGG + Intergenic
996348928 5:122517168-122517190 ATGGTGGTTATCAGAGGCTAGGG - Intergenic
1001942908 5:175753348-175753370 AGGGGGCCTCTCAGAGGCTTCGG + Intergenic
1009871136 6:69452933-69452955 ATGGTGTTTATCAGAGGCTAGGG + Intergenic
1021435537 7:20610277-20610299 ATGGTGGTTATCAGAGGCTACGG + Intergenic
1024054762 7:45652899-45652921 CTGGGGCATCTCCAAGGCTCTGG + Intronic
1024842590 7:53603837-53603859 ATGAGGCTCCTCCAAGGCTCAGG + Intergenic
1025733842 7:64129715-64129737 ATGGGGCCTGTCGGGGGCTAGGG - Intronic
1031204645 7:118741194-118741216 ATGGGGCTTACCAGAGGTTAGGG + Intergenic
1034898998 7:154895970-154895992 CTGGGGCATCTCTGAGGCCATGG + Intergenic
1036395156 8:8363538-8363560 ATGGTGGTTCCCAGAGGCTAAGG + Intronic
1036646321 8:10612957-10612979 TTGGGGCTTCTCAGAGCCTGGGG - Exonic
1037023590 8:14004588-14004610 CTAGGGCTTGTCAGAGGCTAAGG + Intergenic
1037404693 8:18529124-18529146 CTGGGACTTCACCCAGGCTACGG + Exonic
1040023530 8:42761558-42761580 CTGGAGCTTCTCCGAGCCTGCGG - Intronic
1040402271 8:47063243-47063265 ATGTGGCTTGGCCAAGGCTATGG + Intergenic
1040414968 8:47187802-47187824 ATGGGGCTTCTCCTAGGAGCTGG + Intergenic
1041560733 8:59215367-59215389 AGGGGGCTTCCCCAAGGCTCAGG - Intergenic
1044899285 8:96926831-96926853 CTGGGGCCTCTCCGGGGCTTGGG - Intronic
1047824098 8:128554183-128554205 ATGGTGCTTCTCCTGGGCTCTGG + Intergenic
1050764395 9:9114364-9114386 AAGGGGCCTTTCCTAGGCTAAGG - Intronic
1050836097 9:10080540-10080562 ATGAGTCTTCTGCGAGGCCAGGG - Intronic
1053072810 9:35111198-35111220 ATGGGGCCTGTCCCAGGCTGTGG - Exonic
1061390751 9:130315918-130315940 ATGGGGCTTCTGAGAGGTGATGG - Intronic
1062171067 9:135134987-135135009 AAGGCGCTTCCCCGAGGCTCAGG - Intergenic
1203760736 EBV:12213-12235 ATGGGGCTTGGCCGGGTCTAAGG - Intergenic
1203761665 EBV:15285-15307 ATGGGGCTTGGCCGGGTCTAAGG - Intergenic
1203762594 EBV:18357-18379 ATGGGGCTTGGCCGGGTCTAAGG - Intergenic
1203763523 EBV:21429-21451 ATGGGGCTTGGCCGGGTCTAAGG - Intergenic
1203764452 EBV:24501-24523 ATGGGGCTTGGCCGGGTCTAAGG - Intergenic
1203765381 EBV:27573-27595 ATGGGGCTTGGCCGGGTCTAAGG - Intergenic
1203766310 EBV:30645-30667 ATGGGGCTTGGCCGGGTCTAAGG - Intergenic
1203767239 EBV:33717-33739 ATGGGGCTTGGCCGGGTCTAAGG - Intergenic
1187118622 X:16381038-16381060 ATGGAGCTTCTTCCAGGCTATGG - Intergenic
1194832917 X:98647243-98647265 AGGGGGCTTCTTGGAGGCAATGG + Intergenic
1194855496 X:98922974-98922996 CTGAGGCTTCTCTGAAGCTATGG - Intergenic
1195710268 X:107767737-107767759 ATGGGGCTCCTCCTAGCCCATGG + Intronic
1199111406 X:143939763-143939785 CTGGGGCCTCTCAGAGGGTAGGG + Intergenic
1199211944 X:145223015-145223037 ATGGGATGTCTCTGAGGCTAAGG - Intergenic