ID: 956961597

View in Genome Browser
Species Human (GRCh38)
Location 3:74408735-74408757
Sequence TAGGGTAATTACTCTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956961597 Original CRISPR TAGGGTAATTACTCTGAAGA AGG (reversed) Intronic
902640982 1:17765983-17766005 TACAGTAATTACTCTGCAGGAGG - Intronic
907839998 1:58147701-58147723 TTGGGTATGTACTCTGCAGAGGG - Intronic
908377345 1:63557055-63557077 TAAGGCAACTACGCTGAAGAAGG - Intronic
908504456 1:64782352-64782374 TAGGGTAAAAACTGTGAAGAAGG - Intronic
909728747 1:78868542-78868564 TAGCCTAATTAATCTGAAGGAGG + Intergenic
910164871 1:84315719-84315741 TTGGATAAATACTCTGAAGTGGG + Intronic
910593453 1:88952738-88952760 TAGGGTAAATTCTTAGAAGATGG + Intronic
910701360 1:90077957-90077979 TTGGGTATATACTCAGAAGAGGG + Intergenic
911673573 1:100634232-100634254 TAGGGCAATTAGTCAGGAGAAGG - Intergenic
911737802 1:101356700-101356722 TTGGGTAAATACTCGGAAGTGGG + Intergenic
912217378 1:107630482-107630504 TAGATTACTTACTCTGAAGTGGG - Intronic
913682282 1:121197714-121197736 TAGGGCAGTGACTCTAAAGAGGG - Intronic
914034119 1:143985335-143985357 TAGGGCAGTGACTCTAAAGAGGG - Intergenic
914155328 1:145082635-145082657 TAGGGCAGTGACTCTAAAGAGGG + Intronic
917383430 1:174440429-174440451 TAGGGTAATGATAGTGAAGATGG + Intronic
917939158 1:179900146-179900168 AAGGTCAATTTCTCTGAAGAAGG + Exonic
919267228 1:195285438-195285460 TAAGCTAATTACTGTGAAGTGGG - Intergenic
919759753 1:201090150-201090172 TAGGCTCAATGCTCTGAAGATGG + Intronic
920469595 1:206216225-206216247 TAGGGCAGTGACTCTAAAGAGGG - Intronic
920903972 1:210142130-210142152 TAATGTCATTTCTCTGAAGATGG + Intronic
924541086 1:244981424-244981446 TAGAGCACTTACTCTGAAGTAGG + Intronic
1062790980 10:306465-306487 TCGTCTAATTACTCTGGAGAAGG - Intronic
1063738404 10:8789444-8789466 AAGAGCTATTACTCTGAAGATGG - Intergenic
1065206485 10:23362216-23362238 CAGGGCAATTACTATGAACAGGG - Intergenic
1068987835 10:63123351-63123373 TTAGGTAGTTACTCTGAGGAAGG - Intergenic
1070405978 10:76095493-76095515 TTGGGTAATTACTTGGAAGTTGG + Intronic
1072013138 10:91322043-91322065 TAGGGTAATTAGGCAGGAGAAGG - Intergenic
1073508208 10:104021909-104021931 TAGGGTCATTGCTCTGAAGGAGG + Intronic
1074495035 10:113972630-113972652 CAGGGTGATTACTTTGAAGAAGG - Intergenic
1074778899 10:116786112-116786134 TCGGGTAATTACGCAGGAGATGG + Intergenic
1077901136 11:6489887-6489909 TAAGGTAATAACAATGAAGATGG - Intronic
1080439048 11:32273540-32273562 TAGAGTAACTTCTCTGATGAAGG - Intergenic
1083964227 11:66033231-66033253 TAGTGTAAATACTCTCACGATGG + Intergenic
1086856365 11:91870957-91870979 TAGGGTTATAGCACTGAAGATGG + Intergenic
1087362767 11:97181643-97181665 TGGGGTAATTACTCTCACTATGG - Intergenic
1091916250 12:4273338-4273360 TAGGGTAGATTATCTGAAGATGG - Intergenic
1093510935 12:19927525-19927547 TCGGGTAAATACTCAGAAGTGGG + Intergenic
1095377961 12:41554125-41554147 TAGGATAATTCCTCTGATTAGGG + Intronic
1096673146 12:53211834-53211856 AAGGGCCATTACTCTGAAGATGG - Exonic
1098898862 12:76092231-76092253 TTGGGTAACTACTCAGTAGAAGG - Intergenic
1099687870 12:85912245-85912267 TAGGTTTATTCCTCTGAATATGG + Intergenic
1100954874 12:99895745-99895767 TAGGCCAATTACTCTGAGTAAGG - Intronic
1101609011 12:106273471-106273493 GAGGGTAAGTACTCTAAAGATGG + Intronic
1102558857 12:113747875-113747897 TAGGGTGAGTGCTGTGAAGACGG - Intergenic
1104239825 12:126977371-126977393 TTGGGTAAATACTCAGAAGTAGG - Intergenic
1104482053 12:129116027-129116049 TGGGGGAATTTCTCTGCAGATGG - Intronic
1107750544 13:43561135-43561157 TAGGGTAATCACTGTGAAGCAGG - Intronic
1107998484 13:45885032-45885054 TAGAGTAATTACTATGTACAAGG - Intergenic
1109874285 13:68379060-68379082 TTAGGAAATTACTCTGAAAAGGG - Intergenic
1112374284 13:98824461-98824483 TGGGGTAATGACCCTGAAGGCGG + Exonic
1114354780 14:21895478-21895500 TTGAGTAGTTGCTCTGAAGATGG + Intergenic
1114909939 14:27179089-27179111 TAGGTTTATTAATCTTAAGAAGG - Intergenic
1116902079 14:50371243-50371265 TTGGGTAAATACTCAGAAGTGGG + Intronic
1117211291 14:53503021-53503043 TAGGGAAAATGCCCTGAAGATGG - Intergenic
1117830879 14:59748471-59748493 TAGGGTCATTTTTCTTAAGACGG - Intronic
1120356660 14:83442805-83442827 CAGGGTTAGGACTCTGAAGAAGG + Intergenic
1120454408 14:84713865-84713887 TAGGGTACTCACTCTCAAAAAGG - Intergenic
1121463041 14:94096731-94096753 TAGGGTAGTTACTCAAAAGTGGG + Intronic
1121926134 14:97928944-97928966 TGGCCTAATCACTCTGAAGAAGG + Intronic
1124013404 15:25857762-25857784 TAAGGTAATAACTGTGAACACGG + Intronic
1126181379 15:45788193-45788215 TTTGGAAATTACTCTGAAGGAGG + Intergenic
1127019289 15:54727735-54727757 TAGGTTTGTTACTGTGAAGAGGG - Intergenic
1127512195 15:59653985-59654007 TAGGGTAATAGCATTGAAGATGG - Intronic
1127678582 15:61270301-61270323 AAGAGTAATTACTCTGAGAAGGG - Intergenic
1128491206 15:68147116-68147138 TAGGGTAAATTCTCAGAAGTGGG + Intronic
1131307924 15:91261810-91261832 AATGGTAATTTCTATGAAGATGG + Intronic
1132287192 15:100671769-100671791 TTGGGTAATTCCTCTTAAAAAGG - Intergenic
1139008754 16:62606709-62606731 CAGGTTAAATACGCTGAAGATGG - Intergenic
1139183444 16:64774178-64774200 TTGGGTAAATACTCAGAAGTAGG + Intergenic
1141209758 16:81966588-81966610 TAGGGAAAACACTCTAAAGAGGG + Intergenic
1146320244 17:31841216-31841238 TAGGGTAATGGCTATGGAGATGG - Intergenic
1153106350 18:1532510-1532532 TAGACTAATGACTCTGAAGTAGG - Intergenic
1154241785 18:12658763-12658785 TACGGTGCTTACCCTGAAGATGG - Exonic
1156122879 18:33865672-33865694 AAGGGTAAGTTATCTGAAGATGG - Intronic
1156608249 18:38694712-38694734 TATGGTAAATATTCTGAAAAAGG - Intergenic
1156714767 18:39994663-39994685 TAGGGAAATTACTCTGGCTATGG - Intergenic
1158360972 18:56672997-56673019 TATGGTAAATGCTTTGAAGAGGG + Intronic
1159868671 18:73735780-73735802 TAAGGTAATTACTGGGCAGATGG + Intergenic
1163166370 19:15500819-15500841 TTAGGTTATTACTCTGAGGAAGG - Intergenic
1163660807 19:18576128-18576150 TATGATAATCACTCTTAAGAAGG + Exonic
1164237261 19:23348030-23348052 TTGGGTAATTTGTCTGAGGAAGG - Intronic
1166535458 19:43571264-43571286 TAGGGAAAAGACTCTGAAGCTGG - Intronic
1166650393 19:44569919-44569941 CAGAATAATTACTCAGAAGAAGG + Intergenic
1167363441 19:49042520-49042542 GAGGCCAATAACTCTGAAGAAGG + Intergenic
926619577 2:15035209-15035231 TAGGGTAAATACTGAGAAGTGGG + Intergenic
929932058 2:46265282-46265304 TAGGGTAAATACCTTGAAGTAGG - Intergenic
937695599 2:124805118-124805140 AAGGGACATTACCCTGAAGAAGG + Intronic
941033584 2:160541178-160541200 CTGCGTTATTACTCTGAAGATGG + Intergenic
941876429 2:170438431-170438453 TTAGGTAAATACTCAGAAGAGGG + Intronic
945506864 2:210652446-210652468 TAGAGTAATGACACTAAAGATGG + Intronic
948124907 2:235557385-235557407 AAGGGAAATCACTCCGAAGACGG + Intronic
1169958910 20:11136952-11136974 AAGGGTAATGCCTCAGAAGAAGG - Intergenic
1172287102 20:33748398-33748420 TAGGGTATGTACTTTGCAGAGGG + Intronic
1173444027 20:43101794-43101816 TAGGGGCAATTCTCTGAAGAGGG + Intronic
1174744541 20:53048497-53048519 GAGGGTAATGGCTCTGATGATGG - Intronic
1182143580 22:27983080-27983102 AAGAGTAATAACCCTGAAGACGG - Exonic
951284296 3:20790558-20790580 TGGAGCAATTACTCTGAAGTGGG + Intergenic
952790764 3:37198885-37198907 TAGGGTTTTTCCTCTTAAGAGGG - Intergenic
953069250 3:39502962-39502984 TTGGGTAATAAGGCTGAAGAGGG - Intronic
956481769 3:69680196-69680218 TTGGGTGATAACTCTGTAGAAGG + Intergenic
956961597 3:74408735-74408757 TAGGGTAATTACTCTGAAGAAGG - Intronic
957254696 3:77821791-77821813 TAGGCTGTTTACTCTGATGATGG + Intergenic
957853886 3:85847792-85847814 TAGGGCTATAACTCTGAGGAAGG + Intronic
958506740 3:94988549-94988571 AAGGGTAATTCCACTGCAGAGGG - Intergenic
959408770 3:105995104-105995126 CAGGGTAATTAGGCTGGAGAAGG + Intergenic
959610348 3:108287211-108287233 TAGGGTCATTTCTCTGCGGAAGG - Intergenic
960444231 3:117728170-117728192 TAGGATAATTATTATGAATAAGG + Intergenic
960913495 3:122673778-122673800 TGGGCTTATAACTCTGAAGAAGG + Intergenic
961930762 3:130530303-130530325 TAGGGTATGGACTCTGAAGCCGG + Intergenic
964598711 3:158470384-158470406 AAGGTCAATTACACTGAAGATGG - Intronic
973095076 4:46187030-46187052 GAGGTTAAGTACTCTGTAGAAGG - Intergenic
973197895 4:47466549-47466571 TTGGGTAATTATGCTGAATAAGG - Intergenic
974404781 4:61452048-61452070 CTGGGGAATTACTCTGAAAAAGG - Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977088516 4:92636980-92637002 TAGGCTGATTACTTTGATGAGGG - Intronic
978017434 4:103762785-103762807 TTGGCTAATAACTTTGAAGAGGG - Intergenic
978245726 4:106570296-106570318 TAACCTAATGACTCTGAAGATGG + Intergenic
980321066 4:131276444-131276466 TATGTTAATCACTATGAAGAGGG + Intergenic
980420428 4:132552509-132552531 TAGGGTAATTACTTTCAAGCAGG - Intergenic
981449683 4:144881951-144881973 TAGGGTAATGACAGTGAATAGGG - Intergenic
981686750 4:147463272-147463294 TTGGGTAAATACTCAGAAGTTGG - Intergenic
983651830 4:170043451-170043473 TAAGGTGATTAATCTGAAGGTGG - Intergenic
983799807 4:171913047-171913069 TTGGGTAAATACTCAGCAGAGGG + Intronic
987480527 5:18450966-18450988 TAGGGAAATTACTGATAAGAAGG + Intergenic
987730029 5:21757908-21757930 TAGGGTACTGACTGTGAAGATGG - Intronic
987923508 5:24312789-24312811 TAAGGCATTTACTATGAAGAGGG - Intergenic
988880658 5:35498382-35498404 TAGGGCAATTACACAGGAGAAGG + Intergenic
989263014 5:39439779-39439801 TAGGGTAATTATTCATAACAAGG + Intronic
990489384 5:56289201-56289223 TAGGGTAAGAACTCTGGAGTAGG - Intergenic
991220999 5:64217358-64217380 TAGGGTAAATACTCAGGAGTGGG + Exonic
994055034 5:95405616-95405638 TAGGTTAATTACTTTTAAAAAGG + Intronic
994844468 5:104969471-104969493 TAAGGTATTAAATCTGAAGATGG + Intergenic
996541702 5:124636711-124636733 TAGGGTAAATACCCTGTAAATGG + Intergenic
996771811 5:127094303-127094325 CTGGGAAATTGCTCTGAAGAGGG + Intergenic
996941282 5:129008755-129008777 TAAGGTAATTATTCTGCAAATGG - Intronic
998805065 5:145910417-145910439 TGGGGAAATTACTGGGAAGAAGG - Intergenic
998948351 5:147365130-147365152 TAGGTTAATTACTTGGGAGATGG - Intronic
1000467512 5:161598058-161598080 TTGGGTATATACTCAGAAGAGGG - Intronic
1004089205 6:12482619-12482641 TAGGATAATTTCTAAGAAGAGGG + Intergenic
1004670766 6:17794383-17794405 TACGGGAATGACCCTGAAGAGGG + Exonic
1005871996 6:29981253-29981275 GAGGGGAAGTCCTCTGAAGAAGG - Intergenic
1008402427 6:51079204-51079226 TAGGGTAATGACTTTGGGGATGG + Intergenic
1013979889 6:116117942-116117964 AAGGGTAAGTATTGTGAAGAGGG + Exonic
1014376122 6:120677141-120677163 TACGATAATTAATCTGTAGATGG + Intergenic
1015118702 6:129677448-129677470 TAGTGTAATTATTATGAACAAGG - Intronic
1015688403 6:135892766-135892788 TATTGTAATTCCTATGAAGATGG - Intronic
1018247612 6:161837758-161837780 TTGGGAAATAAGTCTGAAGAAGG + Intronic
1019316445 7:389121-389143 TGGGGTGATTACTTTGAAAACGG - Intergenic
1019830725 7:3326510-3326532 TAGGGTAAATACTTTGAAGTAGG + Intronic
1020507893 7:9017302-9017324 TAAGGCATTTACTATGAAGAGGG + Intergenic
1020968239 7:14900171-14900193 TTGGGTATTTACTATGAAGTAGG - Intronic
1024244258 7:47457273-47457295 CTGGGTAATTCCACTGAAGATGG + Intronic
1027168472 7:75853024-75853046 TGGGGTATTTTCCCTGAAGAGGG - Intronic
1027689220 7:81321228-81321250 TAGGCTAAATACTATGAATAAGG - Intergenic
1028775180 7:94667872-94667894 TAGAGTAATTACTTTTAAAATGG + Exonic
1030805354 7:113911555-113911577 TAAGGTAGTTCTTCTGAAGATGG - Intronic
1030941129 7:115650969-115650991 TAATGTAATGACTCTGAAGGGGG + Intergenic
1031047740 7:116912066-116912088 TAGGTTCATTATTATGAAGATGG + Exonic
1033109226 7:138559976-138559998 TAGGGGAATTAACCTTAAGAAGG - Intronic
1037130457 8:15402446-15402468 TAGAGGAATTACTCTGCAGGAGG - Intergenic
1037712312 8:21364649-21364671 GAGGGTAATTACTTAGAAGCTGG - Intergenic
1038974525 8:32678640-32678662 TATGCTAATTGCTCTGAAGAAGG - Intronic
1041798459 8:61772170-61772192 CAGGCTGATTTCTCTGAAGAAGG + Intergenic
1042628144 8:70782927-70782949 TTGGGTAAATACTCAGAAGTGGG + Intronic
1043822800 8:84889421-84889443 TAGGAGAATTTCTCAGAAGAAGG - Intronic
1044025253 8:87162028-87162050 TGGGAGAATTACTCTGAACAGGG + Intronic
1044387468 8:91606599-91606621 CATGGTGTTTACTCTGAAGAGGG - Intergenic
1044630430 8:94273029-94273051 TAGGGTAATAATTATGATGATGG - Intergenic
1045485693 8:102629194-102629216 CAGGTTAATCACTCTGAAGGGGG - Intergenic
1046146015 8:110159516-110159538 AAGGGTCATTAGTCTGAAGTTGG - Intergenic
1047644986 8:126860921-126860943 TTGGGTAAATACTCAGAAGTGGG + Intergenic
1050511223 9:6397796-6397818 TAGGATGATGGCTCTGAAGAGGG - Intergenic
1050760153 9:9058859-9058881 TAATGTAATTCCTCTGAAGATGG + Intronic
1052132987 9:24872929-24872951 TAGGGTAAATACTCAGAAGTGGG + Intergenic
1052153138 9:25144813-25144835 TAGTGTAATAACTCTAAATACGG - Intergenic
1052237220 9:26226014-26226036 TGGGGTACTTTCTTTGAAGATGG + Intergenic
1052714022 9:32093093-32093115 TTAGGTAATTACTCGGAAGCAGG - Intergenic
1058673048 9:107376889-107376911 TTGGGTAAATACCCAGAAGAGGG - Intergenic
1187975514 X:24701372-24701394 TAGGGTATTAACTCTTCAGATGG + Intronic
1188758570 X:33996245-33996267 TAGGTCAATTTCTGTGAAGAGGG + Intergenic
1194281542 X:91959796-91959818 TTGGATATATACTCTGAAGAGGG + Intronic
1195120501 X:101745756-101745778 TTGGGCAATTACTCTCTAGAAGG + Intergenic
1196187086 X:112755862-112755884 TATGGTTATTACTATGAGGAAGG - Intergenic
1199013687 X:142786702-142786724 TGCGGTCATTACTCTCAAGAAGG - Intergenic
1199568348 X:149241903-149241925 TTGGGTATATACTCAGAAGAAGG - Intergenic
1199806316 X:151304433-151304455 GAGGGTAGCTACTGTGAAGAGGG - Intergenic
1200599134 Y:5184451-5184473 TTGGATATATACTCTGAAGAGGG + Intronic