ID: 956971287

View in Genome Browser
Species Human (GRCh38)
Location 3:74529870-74529892
Sequence TCATGGAAGGAGAGTGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956971282_956971287 0 Left 956971282 3:74529847-74529869 CCATTCTGTTCCTCACCTCATAA No data
Right 956971287 3:74529870-74529892 TCATGGAAGGAGAGTGATCTTGG No data
956971281_956971287 5 Left 956971281 3:74529842-74529864 CCAGACCATTCTGTTCCTCACCT No data
Right 956971287 3:74529870-74529892 TCATGGAAGGAGAGTGATCTTGG No data
956971284_956971287 -10 Left 956971284 3:74529857-74529879 CCTCACCTCATAATCATGGAAGG No data
Right 956971287 3:74529870-74529892 TCATGGAAGGAGAGTGATCTTGG No data
956971280_956971287 6 Left 956971280 3:74529841-74529863 CCCAGACCATTCTGTTCCTCACC No data
Right 956971287 3:74529870-74529892 TCATGGAAGGAGAGTGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956971287 Original CRISPR TCATGGAAGGAGAGTGATCT TGG Intergenic
No off target data available for this crispr