ID: 956971299

View in Genome Browser
Species Human (GRCh38)
Location 3:74530033-74530055
Sequence TCATGGAAGGAGAGTGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956971292_956971299 6 Left 956971292 3:74530004-74530026 CCCAGACCATTCTGTTCCTCACC No data
Right 956971299 3:74530033-74530055 TCATGGAAGGAGAGTGATCTTGG No data
956971294_956971299 0 Left 956971294 3:74530010-74530032 CCATTCTGTTCCTCACCTCATAA No data
Right 956971299 3:74530033-74530055 TCATGGAAGGAGAGTGATCTTGG No data
956971293_956971299 5 Left 956971293 3:74530005-74530027 CCAGACCATTCTGTTCCTCACCT No data
Right 956971299 3:74530033-74530055 TCATGGAAGGAGAGTGATCTTGG No data
956971296_956971299 -10 Left 956971296 3:74530020-74530042 CCTCACCTCATAATCATGGAAGG No data
Right 956971299 3:74530033-74530055 TCATGGAAGGAGAGTGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956971299 Original CRISPR TCATGGAAGGAGAGTGATCT TGG Intergenic
No off target data available for this crispr