ID: 956977000

View in Genome Browser
Species Human (GRCh38)
Location 3:74592313-74592335
Sequence GTGGAGTAAAGGAGTTTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956976998_956977000 -6 Left 956976998 3:74592296-74592318 CCTGTTCTAGAAGCTCAGTGGAG No data
Right 956977000 3:74592313-74592335 GTGGAGTAAAGGAGTTTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956977000 Original CRISPR GTGGAGTAAAGGAGTTTAAC AGG Intergenic
No off target data available for this crispr