ID: 956978986

View in Genome Browser
Species Human (GRCh38)
Location 3:74614667-74614689
Sequence AGCCGGAGCCGGAGTGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956978986_956979004 24 Left 956978986 3:74614667-74614689 CCTCCGCCACTCCGGCTCCGGCT No data
Right 956979004 3:74614714-74614736 GGAGGGGAGACCGGGCGGACTGG No data
956978986_956978995 2 Left 956978986 3:74614667-74614689 CCTCCGCCACTCCGGCTCCGGCT No data
Right 956978995 3:74614692-74614714 GGCTCCGACGCGGACGCTGGAGG No data
956978986_956979003 19 Left 956978986 3:74614667-74614689 CCTCCGCCACTCCGGCTCCGGCT No data
Right 956979003 3:74614709-74614731 TGGAGGGAGGGGAGACCGGGCGG No data
956978986_956978999 7 Left 956978986 3:74614667-74614689 CCTCCGCCACTCCGGCTCCGGCT No data
Right 956978999 3:74614697-74614719 CGACGCGGACGCTGGAGGGAGGG No data
956978986_956978996 3 Left 956978986 3:74614667-74614689 CCTCCGCCACTCCGGCTCCGGCT No data
Right 956978996 3:74614693-74614715 GCTCCGACGCGGACGCTGGAGGG No data
956978986_956979006 28 Left 956978986 3:74614667-74614689 CCTCCGCCACTCCGGCTCCGGCT No data
Right 956979006 3:74614718-74614740 GGGAGACCGGGCGGACTGGAGGG No data
956978986_956979001 15 Left 956978986 3:74614667-74614689 CCTCCGCCACTCCGGCTCCGGCT No data
Right 956979001 3:74614705-74614727 ACGCTGGAGGGAGGGGAGACCGG No data
956978986_956978998 6 Left 956978986 3:74614667-74614689 CCTCCGCCACTCCGGCTCCGGCT No data
Right 956978998 3:74614696-74614718 CCGACGCGGACGCTGGAGGGAGG No data
956978986_956979000 8 Left 956978986 3:74614667-74614689 CCTCCGCCACTCCGGCTCCGGCT No data
Right 956979000 3:74614698-74614720 GACGCGGACGCTGGAGGGAGGGG No data
956978986_956978993 -1 Left 956978986 3:74614667-74614689 CCTCCGCCACTCCGGCTCCGGCT No data
Right 956978993 3:74614689-74614711 TCCGGCTCCGACGCGGACGCTGG No data
956978986_956979005 27 Left 956978986 3:74614667-74614689 CCTCCGCCACTCCGGCTCCGGCT No data
Right 956979005 3:74614717-74614739 GGGGAGACCGGGCGGACTGGAGG No data
956978986_956978991 -8 Left 956978986 3:74614667-74614689 CCTCCGCCACTCCGGCTCCGGCT No data
Right 956978991 3:74614682-74614704 CTCCGGCTCCGGCTCCGACGCGG No data
956978986_956979002 16 Left 956978986 3:74614667-74614689 CCTCCGCCACTCCGGCTCCGGCT No data
Right 956979002 3:74614706-74614728 CGCTGGAGGGAGGGGAGACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956978986 Original CRISPR AGCCGGAGCCGGAGTGGCGG AGG (reversed) Intergenic