ID: 956984208

View in Genome Browser
Species Human (GRCh38)
Location 3:74678533-74678555
Sequence GGGAGAGAAGGTCAGACCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956984202_956984208 14 Left 956984202 3:74678496-74678518 CCAAAACTCATGGTGAGATTTGA No data
Right 956984208 3:74678533-74678555 GGGAGAGAAGGTCAGACCTTTGG No data
956984201_956984208 19 Left 956984201 3:74678491-74678513 CCTTTCCAAAACTCATGGTGAGA No data
Right 956984208 3:74678533-74678555 GGGAGAGAAGGTCAGACCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956984208 Original CRISPR GGGAGAGAAGGTCAGACCTT TGG Intergenic
No off target data available for this crispr