ID: 956989859

View in Genome Browser
Species Human (GRCh38)
Location 3:74751079-74751101
Sequence GAGCCAGGTGTGGAGCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956989853_956989859 -5 Left 956989853 3:74751061-74751083 CCCATGCCTGCCGAGGGCGAGCC No data
Right 956989859 3:74751079-74751101 GAGCCAGGTGTGGAGCAGTGAGG No data
956989854_956989859 -6 Left 956989854 3:74751062-74751084 CCATGCCTGCCGAGGGCGAGCCA No data
Right 956989859 3:74751079-74751101 GAGCCAGGTGTGGAGCAGTGAGG No data
956989850_956989859 2 Left 956989850 3:74751054-74751076 CCTGGATCCCATGCCTGCCGAGG No data
Right 956989859 3:74751079-74751101 GAGCCAGGTGTGGAGCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956989859 Original CRISPR GAGCCAGGTGTGGAGCAGTG AGG Intergenic
No off target data available for this crispr