ID: 956999982

View in Genome Browser
Species Human (GRCh38)
Location 3:74874270-74874292
Sequence CTCAAACCTATGCTGCTCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956999982_956999984 23 Left 956999982 3:74874270-74874292 CCCTCGAGCAGCATAGGTTTGAG No data
Right 956999984 3:74874316-74874338 TCTATCTTTTCTTCATTGTCTGG 0: 51
1: 26
2: 17
3: 71
4: 681

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956999982 Original CRISPR CTCAAACCTATGCTGCTCGA GGG (reversed) Intergenic
No off target data available for this crispr