ID: 957004347

View in Genome Browser
Species Human (GRCh38)
Location 3:74926927-74926949
Sequence GGAAAACCCCATAGTAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957004347_957004353 30 Left 957004347 3:74926927-74926949 CCATCTTTACTATGGGGTTTTCC No data
Right 957004353 3:74926980-74927002 ATGATACTACACAGCCACCGTGG No data
957004347_957004351 -7 Left 957004347 3:74926927-74926949 CCATCTTTACTATGGGGTTTTCC No data
Right 957004351 3:74926943-74926965 GTTTTCCAGATGGGGAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957004347 Original CRISPR GGAAAACCCCATAGTAAAGA TGG (reversed) Intergenic
No off target data available for this crispr