ID: 957004351

View in Genome Browser
Species Human (GRCh38)
Location 3:74926943-74926965
Sequence GTTTTCCAGATGGGGAATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957004343_957004351 6 Left 957004343 3:74926914-74926936 CCTCTCTTAACTTCCATCTTTAC No data
Right 957004351 3:74926943-74926965 GTTTTCCAGATGGGGAATATAGG No data
957004341_957004351 13 Left 957004341 3:74926907-74926929 CCTTATCCCTCTCTTAACTTCCA No data
Right 957004351 3:74926943-74926965 GTTTTCCAGATGGGGAATATAGG No data
957004347_957004351 -7 Left 957004347 3:74926927-74926949 CCATCTTTACTATGGGGTTTTCC No data
Right 957004351 3:74926943-74926965 GTTTTCCAGATGGGGAATATAGG No data
957004342_957004351 7 Left 957004342 3:74926913-74926935 CCCTCTCTTAACTTCCATCTTTA No data
Right 957004351 3:74926943-74926965 GTTTTCCAGATGGGGAATATAGG No data
957004340_957004351 14 Left 957004340 3:74926906-74926928 CCCTTATCCCTCTCTTAACTTCC No data
Right 957004351 3:74926943-74926965 GTTTTCCAGATGGGGAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957004351 Original CRISPR GTTTTCCAGATGGGGAATAT AGG Intergenic
No off target data available for this crispr