ID: 957005763

View in Genome Browser
Species Human (GRCh38)
Location 3:74944849-74944871
Sequence TGCCCTGTGTCCTCACATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957005763_957005765 -1 Left 957005763 3:74944849-74944871 CCGCCATGTGAGGACACAGGGCA No data
Right 957005765 3:74944871-74944893 AGCTGTCTGCAAGCCAGAGAAGG No data
957005763_957005767 10 Left 957005763 3:74944849-74944871 CCGCCATGTGAGGACACAGGGCA No data
Right 957005767 3:74944882-74944904 AGCCAGAGAAGGGCTCTCCCTGG No data
957005763_957005766 0 Left 957005763 3:74944849-74944871 CCGCCATGTGAGGACACAGGGCA No data
Right 957005766 3:74944872-74944894 GCTGTCTGCAAGCCAGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957005763 Original CRISPR TGCCCTGTGTCCTCACATGG CGG (reversed) Intergenic
No off target data available for this crispr