ID: 957008359

View in Genome Browser
Species Human (GRCh38)
Location 3:74976410-74976432
Sequence CACCGTATGCTCTCACTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957008357_957008359 18 Left 957008357 3:74976369-74976391 CCATCATTCTCAGCAAACTATCA No data
Right 957008359 3:74976410-74976432 CACCGTATGCTCTCACTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957008359 Original CRISPR CACCGTATGCTCTCACTCAT AGG Intergenic