ID: 957009403

View in Genome Browser
Species Human (GRCh38)
Location 3:74986462-74986484
Sequence TGTGTACACCACCAGGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957009403_957009409 -6 Left 957009403 3:74986462-74986484 CCAGGGCCCTGGTGGTGTACACA No data
Right 957009409 3:74986479-74986501 TACACATCCGGGGAATCTCCTGG No data
957009403_957009413 18 Left 957009403 3:74986462-74986484 CCAGGGCCCTGGTGGTGTACACA No data
Right 957009413 3:74986503-74986525 CTGCGGATTGCAAAAACCATAGG 0: 10
1: 39
2: 112
3: 256
4: 457
957009403_957009411 1 Left 957009403 3:74986462-74986484 CCAGGGCCCTGGTGGTGTACACA No data
Right 957009411 3:74986486-74986508 CCGGGGAATCTCCTGGTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957009403 Original CRISPR TGTGTACACCACCAGGGCCC TGG (reversed) Intergenic
No off target data available for this crispr