ID: 957014042

View in Genome Browser
Species Human (GRCh38)
Location 3:75043062-75043084
Sequence TTTGTTTGGTAGTGAAACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957014039_957014042 24 Left 957014039 3:75043015-75043037 CCTTGGTTGTAGATTGGTTTTAC No data
Right 957014042 3:75043062-75043084 TTTGTTTGGTAGTGAAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957014042 Original CRISPR TTTGTTTGGTAGTGAAACTC AGG Intergenic
No off target data available for this crispr