ID: 957020140

View in Genome Browser
Species Human (GRCh38)
Location 3:75117705-75117727
Sequence GTTAAAACTACTACCTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957020140_957020145 -5 Left 957020140 3:75117705-75117727 CCTTCAGAGGTAGTAGTTTTAAC No data
Right 957020145 3:75117723-75117745 TTAACAGTGGGAGTAGGAACGGG No data
957020140_957020144 -6 Left 957020140 3:75117705-75117727 CCTTCAGAGGTAGTAGTTTTAAC No data
Right 957020144 3:75117722-75117744 TTTAACAGTGGGAGTAGGAACGG No data
957020140_957020146 4 Left 957020140 3:75117705-75117727 CCTTCAGAGGTAGTAGTTTTAAC No data
Right 957020146 3:75117732-75117754 GGAGTAGGAACGGGAATTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957020140 Original CRISPR GTTAAAACTACTACCTCTGA AGG (reversed) Intergenic
No off target data available for this crispr