ID: 957022467

View in Genome Browser
Species Human (GRCh38)
Location 3:75140709-75140731
Sequence GACTGGGAGCTATACATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957022461_957022467 2 Left 957022461 3:75140684-75140706 CCGAGACCATCCTTGGACATCAC No data
Right 957022467 3:75140709-75140731 GACTGGGAGCTATACATGGAAGG No data
957022465_957022467 -8 Left 957022465 3:75140694-75140716 CCTTGGACATCACTAGACTGGGA No data
Right 957022467 3:75140709-75140731 GACTGGGAGCTATACATGGAAGG No data
957022462_957022467 -4 Left 957022462 3:75140690-75140712 CCATCCTTGGACATCACTAGACT No data
Right 957022467 3:75140709-75140731 GACTGGGAGCTATACATGGAAGG No data
957022458_957022467 9 Left 957022458 3:75140677-75140699 CCAACCTCCGAGACCATCCTTGG No data
Right 957022467 3:75140709-75140731 GACTGGGAGCTATACATGGAAGG No data
957022460_957022467 5 Left 957022460 3:75140681-75140703 CCTCCGAGACCATCCTTGGACAT No data
Right 957022467 3:75140709-75140731 GACTGGGAGCTATACATGGAAGG No data
957022457_957022467 10 Left 957022457 3:75140676-75140698 CCCAACCTCCGAGACCATCCTTG No data
Right 957022467 3:75140709-75140731 GACTGGGAGCTATACATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957022467 Original CRISPR GACTGGGAGCTATACATGGA AGG Intergenic
No off target data available for this crispr