ID: 957022501

View in Genome Browser
Species Human (GRCh38)
Location 3:75140957-75140979
Sequence AAAGGCCTATTGAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957022492_957022501 18 Left 957022492 3:75140916-75140938 CCTTTTTAACTCTTCAAGTGCAT No data
Right 957022501 3:75140957-75140979 AAAGGCCTATTGAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957022501 Original CRISPR AAAGGCCTATTGAACTCTGG GGG Intergenic
No off target data available for this crispr