ID: 957023472

View in Genome Browser
Species Human (GRCh38)
Location 3:75151596-75151618
Sequence CTCAGGCATCTAGCCAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957023470_957023472 6 Left 957023470 3:75151567-75151589 CCATTGAAAAATGTTGGAATTAT No data
Right 957023472 3:75151596-75151618 CTCAGGCATCTAGCCAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957023472 Original CRISPR CTCAGGCATCTAGCCAAATT TGG Intergenic
No off target data available for this crispr