ID: 957024684

View in Genome Browser
Species Human (GRCh38)
Location 3:75167936-75167958
Sequence CACTATAGCCCCAAATAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957024684_957024693 21 Left 957024684 3:75167936-75167958 CCCAGCTATTTGGGGCTATAGTG No data
Right 957024693 3:75167980-75168002 CACTTGAGCCCAAAAGTTGGAGG 0: 3
1: 89
2: 1288
3: 7956
4: 30016
957024684_957024692 18 Left 957024684 3:75167936-75167958 CCCAGCTATTTGGGGCTATAGTG No data
Right 957024692 3:75167977-75167999 GATCACTTGAGCCCAAAAGTTGG 0: 7
1: 120
2: 1413
3: 4443
4: 11401
957024684_957024691 -7 Left 957024684 3:75167936-75167958 CCCAGCTATTTGGGGCTATAGTG No data
Right 957024691 3:75167952-75167974 TATAGTGGGGAGACTAAGGGAGG No data
957024684_957024690 -10 Left 957024684 3:75167936-75167958 CCCAGCTATTTGGGGCTATAGTG No data
Right 957024690 3:75167949-75167971 GGCTATAGTGGGGAGACTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957024684 Original CRISPR CACTATAGCCCCAAATAGCT GGG (reversed) Intergenic
No off target data available for this crispr