ID: 957026240

View in Genome Browser
Species Human (GRCh38)
Location 3:75185580-75185602
Sequence TTCTTTGCAAGGCAGTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957026240_957026245 -3 Left 957026240 3:75185580-75185602 CCCTGCAACTGCCTTGCAAAGAA No data
Right 957026245 3:75185600-75185622 GAAACCTAAGCTAGACTGGTGGG No data
957026240_957026243 -7 Left 957026240 3:75185580-75185602 CCCTGCAACTGCCTTGCAAAGAA No data
Right 957026243 3:75185596-75185618 CAAAGAAACCTAAGCTAGACTGG No data
957026240_957026244 -4 Left 957026240 3:75185580-75185602 CCCTGCAACTGCCTTGCAAAGAA No data
Right 957026244 3:75185599-75185621 AGAAACCTAAGCTAGACTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957026240 Original CRISPR TTCTTTGCAAGGCAGTTGCA GGG (reversed) Intergenic