ID: 957026241

View in Genome Browser
Species Human (GRCh38)
Location 3:75185581-75185603
Sequence TTTCTTTGCAAGGCAGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957026241_957026245 -4 Left 957026241 3:75185581-75185603 CCTGCAACTGCCTTGCAAAGAAA No data
Right 957026245 3:75185600-75185622 GAAACCTAAGCTAGACTGGTGGG No data
957026241_957026243 -8 Left 957026241 3:75185581-75185603 CCTGCAACTGCCTTGCAAAGAAA No data
Right 957026243 3:75185596-75185618 CAAAGAAACCTAAGCTAGACTGG No data
957026241_957026244 -5 Left 957026241 3:75185581-75185603 CCTGCAACTGCCTTGCAAAGAAA No data
Right 957026244 3:75185599-75185621 AGAAACCTAAGCTAGACTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957026241 Original CRISPR TTTCTTTGCAAGGCAGTTGC AGG (reversed) Intergenic