ID: 957026243

View in Genome Browser
Species Human (GRCh38)
Location 3:75185596-75185618
Sequence CAAAGAAACCTAAGCTAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957026238_957026243 16 Left 957026238 3:75185557-75185579 CCCTTTCTTGCTGCTTTTTGCAA No data
Right 957026243 3:75185596-75185618 CAAAGAAACCTAAGCTAGACTGG No data
957026241_957026243 -8 Left 957026241 3:75185581-75185603 CCTGCAACTGCCTTGCAAAGAAA No data
Right 957026243 3:75185596-75185618 CAAAGAAACCTAAGCTAGACTGG No data
957026240_957026243 -7 Left 957026240 3:75185580-75185602 CCCTGCAACTGCCTTGCAAAGAA No data
Right 957026243 3:75185596-75185618 CAAAGAAACCTAAGCTAGACTGG No data
957026239_957026243 15 Left 957026239 3:75185558-75185580 CCTTTCTTGCTGCTTTTTGCAAC No data
Right 957026243 3:75185596-75185618 CAAAGAAACCTAAGCTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957026243 Original CRISPR CAAAGAAACCTAAGCTAGAC TGG Intergenic