ID: 957033518

View in Genome Browser
Species Human (GRCh38)
Location 3:75270901-75270923
Sequence CAGGATTAGGTCATAGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957033515_957033518 -2 Left 957033515 3:75270880-75270902 CCTAGATTACGGCATGTGTTGCA No data
Right 957033518 3:75270901-75270923 CAGGATTAGGTCATAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957033518 Original CRISPR CAGGATTAGGTCATAGAGAC AGG Intergenic
No off target data available for this crispr