ID: 957036379

View in Genome Browser
Species Human (GRCh38)
Location 3:75297049-75297071
Sequence CTGTGAGTGTGGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957036379_957036386 28 Left 957036379 3:75297049-75297071 CCTTCTTCCCTCCACACTCACAG No data
Right 957036386 3:75297100-75297122 TAGCACCTGGAAGTGTTGGATGG No data
957036379_957036385 24 Left 957036379 3:75297049-75297071 CCTTCTTCCCTCCACACTCACAG No data
Right 957036385 3:75297096-75297118 ATGTTAGCACCTGGAAGTGTTGG No data
957036379_957036384 15 Left 957036379 3:75297049-75297071 CCTTCTTCCCTCCACACTCACAG No data
Right 957036384 3:75297087-75297109 AGATTTATGATGTTAGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957036379 Original CRISPR CTGTGAGTGTGGAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr