ID: 957037795

View in Genome Browser
Species Human (GRCh38)
Location 3:75311225-75311247
Sequence CCTTCATTAGGCTGGCGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957037795_957037802 -2 Left 957037795 3:75311225-75311247 CCACAGCGCCAGCCTAATGAAGG No data
Right 957037802 3:75311246-75311268 GGGACTCTTTACAAAGGTGTGGG No data
957037795_957037800 -8 Left 957037795 3:75311225-75311247 CCACAGCGCCAGCCTAATGAAGG No data
Right 957037800 3:75311240-75311262 AATGAAGGGACTCTTTACAAAGG No data
957037795_957037807 26 Left 957037795 3:75311225-75311247 CCACAGCGCCAGCCTAATGAAGG No data
Right 957037807 3:75311274-75311296 ATTTAGACTTGAACAAGTAAGGG No data
957037795_957037804 2 Left 957037795 3:75311225-75311247 CCACAGCGCCAGCCTAATGAAGG No data
Right 957037804 3:75311250-75311272 CTCTTTACAAAGGTGTGGGGAGG No data
957037795_957037806 25 Left 957037795 3:75311225-75311247 CCACAGCGCCAGCCTAATGAAGG No data
Right 957037806 3:75311273-75311295 GATTTAGACTTGAACAAGTAAGG No data
957037795_957037803 -1 Left 957037795 3:75311225-75311247 CCACAGCGCCAGCCTAATGAAGG No data
Right 957037803 3:75311247-75311269 GGACTCTTTACAAAGGTGTGGGG No data
957037795_957037805 3 Left 957037795 3:75311225-75311247 CCACAGCGCCAGCCTAATGAAGG No data
Right 957037805 3:75311251-75311273 TCTTTACAAAGGTGTGGGGAGGG No data
957037795_957037801 -3 Left 957037795 3:75311225-75311247 CCACAGCGCCAGCCTAATGAAGG No data
Right 957037801 3:75311245-75311267 AGGGACTCTTTACAAAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957037795 Original CRISPR CCTTCATTAGGCTGGCGCTG TGG (reversed) Intergenic
No off target data available for this crispr