ID: 957038888

View in Genome Browser
Species Human (GRCh38)
Location 3:75320938-75320960
Sequence AGACAGGAGTTAGAGGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957038888_957038891 3 Left 957038888 3:75320938-75320960 CCTGTGGCCTCTAACTCCTGTCT No data
Right 957038891 3:75320964-75320986 GCTATTCCACTTCTTAGTGCTGG No data
957038888_957038893 9 Left 957038888 3:75320938-75320960 CCTGTGGCCTCTAACTCCTGTCT No data
Right 957038893 3:75320970-75320992 CCACTTCTTAGTGCTGGTTTAGG No data
957038888_957038894 30 Left 957038888 3:75320938-75320960 CCTGTGGCCTCTAACTCCTGTCT No data
Right 957038894 3:75320991-75321013 GGACCAGACATTGTCTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957038888 Original CRISPR AGACAGGAGTTAGAGGCCAC AGG (reversed) Intergenic
No off target data available for this crispr