ID: 957044055

View in Genome Browser
Species Human (GRCh38)
Location 3:75360615-75360637
Sequence CCTCATATTCAGAGGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957044047_957044055 18 Left 957044047 3:75360574-75360596 CCCAATATCGCAGGAGGTGTACA No data
Right 957044055 3:75360615-75360637 CCTCATATTCAGAGGGAGAGAGG No data
957044048_957044055 17 Left 957044048 3:75360575-75360597 CCAATATCGCAGGAGGTGTACAC No data
Right 957044055 3:75360615-75360637 CCTCATATTCAGAGGGAGAGAGG No data
957044051_957044055 -9 Left 957044051 3:75360601-75360623 CCTGTGAAAATCTTCCTCATATT No data
Right 957044055 3:75360615-75360637 CCTCATATTCAGAGGGAGAGAGG No data
957044049_957044055 -7 Left 957044049 3:75360599-75360621 CCCCTGTGAAAATCTTCCTCATA No data
Right 957044055 3:75360615-75360637 CCTCATATTCAGAGGGAGAGAGG No data
957044050_957044055 -8 Left 957044050 3:75360600-75360622 CCCTGTGAAAATCTTCCTCATAT No data
Right 957044055 3:75360615-75360637 CCTCATATTCAGAGGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957044055 Original CRISPR CCTCATATTCAGAGGGAGAG AGG Intergenic
No off target data available for this crispr