ID: 957044389

View in Genome Browser
Species Human (GRCh38)
Location 3:75362712-75362734
Sequence AAGGTCCTATTGAACTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957044389_957044394 8 Left 957044389 3:75362712-75362734 CCCCCAGAGTTCAATAGGACCTT No data
Right 957044394 3:75362743-75362765 ATCATGCTCCATGCACTTGAAGG No data
957044389_957044395 9 Left 957044389 3:75362712-75362734 CCCCCAGAGTTCAATAGGACCTT No data
Right 957044395 3:75362744-75362766 TCATGCTCCATGCACTTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957044389 Original CRISPR AAGGTCCTATTGAACTCTGG GGG (reversed) Intergenic
No off target data available for this crispr