ID: 957044567

View in Genome Browser
Species Human (GRCh38)
Location 3:75363831-75363853
Sequence CACGGCATTCGGGTGTGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957044567_957044577 10 Left 957044567 3:75363831-75363853 CCTTGGCACACCCGAATGCCGTG No data
Right 957044577 3:75363864-75363886 GCAGAAGGTCATCAACCTACTGG No data
957044567_957044579 28 Left 957044567 3:75363831-75363853 CCTTGGCACACCCGAATGCCGTG No data
Right 957044579 3:75363882-75363904 ACTGGAGCAACACGCAGCCTAGG 0: 26
1: 29
2: 29
3: 28
4: 121
957044567_957044574 -5 Left 957044567 3:75363831-75363853 CCTTGGCACACCCGAATGCCGTG No data
Right 957044574 3:75363849-75363871 CCGTGGGGTGTCCCAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957044567 Original CRISPR CACGGCATTCGGGTGTGCCA AGG (reversed) Intergenic
No off target data available for this crispr