ID: 957046004

View in Genome Browser
Species Human (GRCh38)
Location 3:75375174-75375196
Sequence AAGGACAGTTCAGTGAGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957046004_957046009 2 Left 957046004 3:75375174-75375196 CCTACACTCACTGAACTGTCCTT No data
Right 957046009 3:75375199-75375221 CCTCTGATGAGCCATGACCACGG No data
957046004_957046010 10 Left 957046004 3:75375174-75375196 CCTACACTCACTGAACTGTCCTT No data
Right 957046010 3:75375207-75375229 GAGCCATGACCACGGAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957046004 Original CRISPR AAGGACAGTTCAGTGAGTGT AGG (reversed) Intergenic
No off target data available for this crispr