ID: 957046706

View in Genome Browser
Species Human (GRCh38)
Location 3:75381222-75381244
Sequence TCGCATCCCCGGCCCCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 5, 1: 2, 2: 1, 3: 18, 4: 302}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957046706_957046712 21 Left 957046706 3:75381222-75381244 CCACAGTGGGGCCGGGGATGCGA 0: 5
1: 2
2: 1
3: 18
4: 302
Right 957046712 3:75381266-75381288 GTCTCCAGCAGCATTGAGGATGG No data
957046706_957046709 -7 Left 957046706 3:75381222-75381244 CCACAGTGGGGCCGGGGATGCGA 0: 5
1: 2
2: 1
3: 18
4: 302
Right 957046709 3:75381238-75381260 GATGCGACTGAGAGTTGTCTGGG 0: 4
1: 3
2: 0
3: 6
4: 77
957046706_957046710 17 Left 957046706 3:75381222-75381244 CCACAGTGGGGCCGGGGATGCGA 0: 5
1: 2
2: 1
3: 18
4: 302
Right 957046710 3:75381262-75381284 ACCTGTCTCCAGCAGCATTGAGG No data
957046706_957046708 -8 Left 957046706 3:75381222-75381244 CCACAGTGGGGCCGGGGATGCGA 0: 5
1: 2
2: 1
3: 18
4: 302
Right 957046708 3:75381237-75381259 GGATGCGACTGAGAGTTGTCTGG 0: 4
1: 3
2: 0
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957046706 Original CRISPR TCGCATCCCCGGCCCCACTG TGG (reversed) Intergenic
900658522 1:3772018-3772040 ACGCTTCCCCGGCGCCTCTGAGG + Intergenic
902595876 1:17509057-17509079 TCTCATCAGGGGCCCCACTGAGG + Intergenic
903566944 1:24274773-24274795 TGGCATTCCAGGCACCACTGCGG + Intergenic
906557825 1:46728464-46728486 TGGCATTCCAGGCACCACTGGGG - Intergenic
907185769 1:52608050-52608072 TCTCAACCTCGGCCCCACTTTGG + Intronic
907316742 1:53577204-53577226 GCGCATCCCCTACCCCCCTGGGG + Intronic
909403267 1:75258158-75258180 TGGCATTCCAGGCGCCACTGGGG - Intronic
909415645 1:75402813-75402835 TGGCATTCCAGGCACCACTGGGG - Intronic
909536448 1:76741660-76741682 TGGCATTCCAGGCGCCACTGGGG + Intergenic
909672378 1:78203523-78203545 TGGCATTCCAGGCGCCACTGGGG - Intergenic
909690168 1:78398249-78398271 TGGCATTCCAGGCACCACTGGGG + Intronic
911982725 1:104586493-104586515 TGGCATTCCCGGCACCACTGGGG - Intergenic
917239422 1:172931711-172931733 TCACATGCCTGGCCCCACTTTGG - Intergenic
917405943 1:174708790-174708812 TGGCATTCCAGGCACCACTGGGG - Intronic
918906832 1:190506403-190506425 TGGCATTCCAGGCACCACTGGGG + Intergenic
919220684 1:194624922-194624944 CCCCACCCCCGCCCCCACTGGGG - Intergenic
919465948 1:197921684-197921706 GCGCAGCCCCGGCCTCCCTGAGG + Intronic
919769511 1:201148282-201148304 TACCAGCCCAGGCCCCACTGAGG - Intronic
921801958 1:219411611-219411633 TCGGGTCCCCTTCCCCACTGTGG + Intergenic
921944895 1:220879721-220879743 TCGCTTCTCCGCCCGCACTGAGG - Exonic
921963572 1:221062906-221062928 TGGCATCCCCCACCCCAATGTGG + Intergenic
922315160 1:224434991-224435013 TCCTATCCCCGGCCCCGCTCGGG + Intronic
922406249 1:225316374-225316396 TGGCATTCCAGGCACCACTGGGG + Intronic
923061276 1:230476651-230476673 TGGCATTCCAGGCACCACTGGGG + Intergenic
923277232 1:232407557-232407579 TCACATTCCAGGCACCACTGTGG - Intronic
924253426 1:242158332-242158354 TGGCCTCCCAGGCACCACTGGGG + Intronic
924254552 1:242169547-242169569 TGGCATTCCAGGCACCACTGGGG - Intronic
924355954 1:243176236-243176258 TCTCATCTCCTTCCCCACTGTGG - Intronic
924670596 1:246120462-246120484 TCTCTTCTCCGGCCCTACTGAGG + Intronic
1065651711 10:27899432-27899454 TGGCATTCCGGGCACCACTGGGG - Intronic
1066620607 10:37345261-37345283 TCTCATGCCCAGCCCCACTGGGG + Intronic
1066623864 10:37385792-37385814 TCTCATGCCCAGCCCCACTGGGG + Intergenic
1067944041 10:50679372-50679394 TGGAAGCCCCGGCCCCACTCGGG - Intergenic
1070349231 10:75575986-75576008 TGGCATTCCAGGCGCCACTGAGG - Intronic
1070865533 10:79706241-79706263 TGGAAGCCCCGGCCCCACTCGGG - Exonic
1070879326 10:79844372-79844394 TGGAAGCCCCGGCCCCACTCGGG - Exonic
1071632434 10:87228462-87228484 TGGAAGCCCCGGCCCCACTCGGG - Exonic
1071645885 10:87360680-87360702 TGGAAGCCCCGGCCCCACTCGGG - Exonic
1074016793 10:109542593-109542615 TGGCATTCCAGGCGCCACTGGGG + Intergenic
1075983948 10:126767068-126767090 TGGCATCCCAGGTGCCACTGGGG + Intergenic
1082272272 11:50184260-50184282 TGGCATCCCCTTCCACACTGTGG + Intergenic
1083417132 11:62533177-62533199 TAGCATCACTGGCCCCAGTGTGG - Exonic
1083510190 11:63202268-63202290 TGGCATTCCAGGCACCACTGGGG - Intronic
1084230138 11:67746194-67746216 TCACATCCCCGGCCCCACTGTGG - Intergenic
1085532610 11:77200926-77200948 TCCCACCCCCCTCCCCACTGAGG - Intronic
1086348841 11:85924728-85924750 TGGCATTCCAGGCACCACTGGGG - Intergenic
1086907348 11:92433256-92433278 TGGCATTCCAGGCACCACTGGGG + Intronic
1087305728 11:96487257-96487279 TGGCATTCCAGGCGCCACTGGGG - Intronic
1087925114 11:103910718-103910740 TGGCATTCCAGGCGCCACTGGGG - Intronic
1088211963 11:107466477-107466499 TGGCATTCCAGGCACCACTGGGG + Intergenic
1089766064 11:120766475-120766497 TGGCATTCCAGGCACCACTGGGG + Intronic
1090688836 11:129156209-129156231 TGGCATTCCAGGCGCCACTGGGG - Intronic
1090896145 11:130977111-130977133 TGGCATTCCAGGCACCACTGGGG + Intergenic
1092690873 12:11108786-11108808 TGGCATTCCAGGCACCACTGGGG - Intronic
1094757825 12:33492687-33492709 TGGCATTCCAGGCACCACTGGGG - Intergenic
1095356391 12:41280332-41280354 TGGCATTCCAGGCACCACTGGGG - Intronic
1097267756 12:57755616-57755638 CCGCCTCCCCGGCCCCCCCGGGG - Exonic
1097488403 12:60234791-60234813 TGGCATTCCAGGCACCACTGGGG - Intergenic
1098052897 12:66472944-66472966 TGGCATTCCAGGCACCACTGGGG - Intronic
1098314051 12:69175296-69175318 TACCACACCCGGCCCCACTGTGG - Intergenic
1100136248 12:91556899-91556921 TGGCATTCCAGGCGCCACTGGGG - Intergenic
1100740015 12:97581510-97581532 TGGCATTCCAGGCGCCACTGGGG - Intergenic
1101069896 12:101062907-101062929 TGGCATTCCAGGCACCACTGGGG + Intronic
1102459370 12:113090701-113090723 TCCCATCCCAGACCCCTCTGAGG - Intronic
1104306937 12:127618009-127618031 TTGCATCCCCTTCCACACTGTGG + Intergenic
1105645819 13:22316470-22316492 TGGCATTCCAGGCGCCACTGGGG + Intergenic
1106612341 13:31295837-31295859 TGGCATTCCAGGCACCACTGGGG + Intronic
1107641998 13:42453192-42453214 TGGCATTCCAGGCACCACTGGGG + Intergenic
1108030112 13:46220624-46220646 TGGCATTCCAGGCACCACTGGGG + Intronic
1108599834 13:51983032-51983054 TGGCATTCCAGGCACCACTGGGG - Intronic
1109195896 13:59377244-59377266 TGGCATTCCAGGCACCACTGGGG - Intergenic
1111635047 13:90892804-90892826 TGGCATTCCAGGCACCACTGAGG - Intergenic
1114433760 14:22686136-22686158 TGGCATTCCAGGCACCACTGGGG - Intergenic
1114501519 14:23172577-23172599 CAGCATTCCCGGCCCAACTGGGG + Intronic
1114844866 14:26309032-26309054 TGGCATTCCAGGCACCACTGGGG - Intergenic
1115162361 14:30410436-30410458 TGGCATTCCAGGCACCACTGGGG + Intergenic
1116771506 14:49131810-49131832 TGGCATTCCAGGCACCACTGGGG + Intergenic
1116958192 14:50944642-50944664 TCCCACCCCCGAGCCCACTGCGG - Exonic
1117170593 14:53090704-53090726 TCACACACCGGGCCCCACTGGGG + Intronic
1117617113 14:57545081-57545103 TGGCATTCCAGGCACCACTGGGG + Intergenic
1117859343 14:60073602-60073624 TCTCATTCCAGGCACCACTGGGG - Intergenic
1118642132 14:67802659-67802681 TCTGATCCCTGGACCCACTGGGG - Intronic
1119018514 14:71084869-71084891 TGGCATTCCAGGCGCCACTGGGG + Intronic
1120770090 14:88369988-88370010 TGGCATTCCAGGCACCACTGCGG - Intergenic
1120843189 14:89104845-89104867 TGGCATTCCAGGCACCACTGGGG + Intergenic
1121013541 14:90535197-90535219 TCCCATCCCCAGCCCCATTTGGG - Exonic
1121470620 14:94151562-94151584 TGGCATTCCAGGCACCACTGTGG + Intronic
1121687195 14:95845316-95845338 CCCCAGCCCAGGCCCCACTGTGG + Intergenic
1121829355 14:97036252-97036274 TCATTTCCCCAGCCCCACTGAGG - Intergenic
1122356926 14:101128641-101128663 TTTCATGCCTGGCCCCACTGAGG + Intergenic
1124954037 15:34348189-34348211 TGCCAGCCCCAGCCCCACTGAGG - Exonic
1127361966 15:58252293-58252315 TTGCATCCACAGCTCCACTGAGG - Intronic
1128742842 15:70095801-70095823 TCACATCCCCCTCCCCACGGCGG - Intronic
1128866482 15:71118485-71118507 TCGCCTCCCCAGCCACTCTGAGG + Intronic
1128883641 15:71265573-71265595 TGGCATTCCAGGCGCCACTGGGG - Intronic
1130728700 15:86467494-86467516 TGGCATTCCAGGCCCCACTGGGG + Intronic
1132697890 16:1210077-1210099 TCGCGGCTCCGGCACCACTGGGG - Exonic
1133235663 16:4386318-4386340 TCTCCTGCCCGGCCCCAGTGTGG - Intronic
1134241185 16:12508241-12508263 ACGCATCCCCGGCCCTGCTCCGG + Intronic
1136355748 16:29744215-29744237 TGGGGTCCCCGGTCCCACTGAGG + Exonic
1136385997 16:29926246-29926268 TCGCAGCCCCGCCCCCATTCAGG - Exonic
1137828062 16:51516900-51516922 TGGCATTCCAGGCACCACTGGGG - Intergenic
1138151517 16:54661780-54661802 TGGCATTCCAGGCACCACTGGGG - Intergenic
1138529677 16:57628281-57628303 TGGCAACCCCGGCCTCTCTGTGG + Intronic
1138651554 16:58464014-58464036 TCGCCTTCCCGGCCGCGCTGGGG + Exonic
1140112556 16:72016350-72016372 CTGTATCCCCAGCCCCACTGTGG - Intronic
1140359513 16:74332520-74332542 TCCCCTCCCCTCCCCCACTGTGG - Intergenic
1140759725 16:78099895-78099917 GTGCGTCCGCGGCCCCACTGCGG - Intronic
1143460394 17:7100214-7100236 TCGGGTCCCCTGCCACACTGTGG - Intergenic
1144586976 17:16492700-16492722 GCGGATCCCAGGCCCCACCGAGG - Intergenic
1145244924 17:21262426-21262448 TCGGTTCCCTGGCCCCACAGTGG - Intergenic
1145957004 17:28861602-28861624 TCCCAGCCAGGGCCCCACTGGGG + Intergenic
1146670305 17:34732970-34732992 TCGCATTGCTGGCCCCACAGAGG - Intergenic
1146722130 17:35130874-35130896 TCCCCTACCCCGCCCCACTGGGG - Intronic
1148967349 17:51447090-51447112 TGGCATTCCAGGCGCCACTGGGG - Intergenic
1151064222 17:71132016-71132038 TGGCATTCCAGGCGCCACTGGGG + Intergenic
1151869379 17:76826170-76826192 TAGCATCCATGGACCCACTGGGG + Intergenic
1152360917 17:79832628-79832650 TCGCCGGCCCTGCCCCACTGAGG - Intergenic
1152550727 17:81028675-81028697 TCACAGCCCCAGCTCCACTGCGG + Intergenic
1152607427 17:81299747-81299769 TCCCATCTCCGGCCCAGCTGAGG + Intergenic
1152657926 17:81528492-81528514 GCGCATCCCAGGCCCCTCCGGGG + Intronic
1155003351 18:21706793-21706815 CCGCACCCCCCGCCCCACTGTGG + Intronic
1156099091 18:33572360-33572382 TCTCACCCCCAGCCTCACTGGGG + Intergenic
1157066593 18:44357202-44357224 TCACATTCCAGGCACCACTGGGG + Intergenic
1158517589 18:58143666-58143688 TCCCATCCACGGCCTCTCTGGGG - Intronic
1159661261 18:71098139-71098161 TGGCATTCCAGGCACCACTGCGG + Intergenic
1160466686 18:79083428-79083450 TGGCATTCCAGGCGCCACTGGGG + Intronic
1160972522 19:1775869-1775891 TCAGATCCCCTGCCCCACCGAGG + Exonic
1160994386 19:1875975-1875997 TCGCAGCCCCGACCCCGCGGCGG + Intergenic
1161725976 19:5929310-5929332 GCTAATCCCCAGCCCCACTGGGG + Intronic
1161865934 19:6832231-6832253 TCCCAGCCCCTGCCCCTCTGTGG - Intronic
1163148745 19:15399110-15399132 ACTCATCCCCTGCCCCTCTGCGG - Intronic
1167056088 19:47112394-47112416 ACGCAGCCCCGGCCCAACCGGGG + Intronic
1167980691 19:53272700-53272722 TCCCATCCCCGTCTCCACTTTGG - Intergenic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
925062652 2:905117-905139 TCTCCTTCCCGCCCCCACTGTGG - Intergenic
925314089 2:2908057-2908079 GTGCATCCCAGGCCCCAGTGTGG + Intergenic
925905976 2:8539836-8539858 TATCATCCCTGGCCCCACTGGGG + Intergenic
925969447 2:9096445-9096467 ACACATACCCGGCCCCACAGTGG + Intergenic
928815756 2:35292827-35292849 TCGCTTCCCAATCCCCACTGGGG - Intergenic
931479166 2:62622290-62622312 TGGCATTCCAGGCGCCACTGGGG + Intergenic
931480358 2:62633404-62633426 TGGCATCCCAGGTGCCACTGGGG - Intergenic
931538633 2:63304716-63304738 TGGCATTCCAGGCACCACTGGGG - Intronic
932715791 2:74100180-74100202 CCCCAGCCCCAGCCCCACTGGGG - Intronic
932913856 2:75834108-75834130 TGGCATTCCAGGCGCCACTGGGG - Intergenic
935710378 2:105893196-105893218 TCGCCTCCCGGGCCCCACGGTGG + Exonic
935982788 2:108643634-108643656 TGGCATTCCTGGCGCCACTGGGG - Intronic
937305699 2:120869168-120869190 TCCCCTCCCTGTCCCCACTGGGG - Intronic
939640880 2:144638692-144638714 TGGCATTCCAGGCACCACTGGGG + Intergenic
939652774 2:144785395-144785417 TGGCATTCCAGGCACCACTGGGG - Intergenic
939840579 2:147182626-147182648 TCGCATTCCAGGCCCCACTGGGG - Intergenic
939937796 2:148313663-148313685 TGGCATTCCAGGCACCACTGGGG + Intronic
941565381 2:167099532-167099554 TGGCATTCCAGGCACCACTGGGG + Intronic
942732562 2:179076021-179076043 TGGCATTCCAGGCACCACTGGGG - Intergenic
942953727 2:181750561-181750583 TGGCATTCCAGGCGCCACTGGGG + Intergenic
943408797 2:187520170-187520192 TGGCATTCCAGGCACCACTGGGG + Intronic
945207194 2:207344575-207344597 TGGCATTCCAGGCACCACTGGGG - Intergenic
945486934 2:210407214-210407236 TGGCATTCCAGGCACCACTGGGG + Intergenic
946410619 2:219513536-219513558 TCCCTTCCACGCCCCCACTGGGG + Intergenic
947026772 2:225744973-225744995 TCGGGTCCCCTTCCCCACTGTGG + Intergenic
948627424 2:239277611-239277633 ACGCATCCCCGGAACCAGTGAGG + Intronic
1170167933 20:13381098-13381120 TGGCATTCCAGGCACCACTGGGG + Intergenic
1172517045 20:35542191-35542213 ACGCGACCCCGGCCCCGCTGCGG - Intronic
1173738103 20:45375923-45375945 TCACCTCCCCTGACCCACTGGGG + Intronic
1173751195 20:45478183-45478205 TGGCATTCCAGGCACCACTGGGG + Intronic
1175499381 20:59439058-59439080 TCGCAGCCCCTGCCCCTCTTTGG - Intergenic
1175610110 20:60343887-60343909 TCACCTCCCTGGACCCACTGTGG - Intergenic
1175824789 20:61930997-61931019 CCGTGGCCCCGGCCCCACTGCGG - Intronic
1176288050 21:5029223-5029245 TCTCAACCCCGGCCACACAGTGG + Intronic
1178393531 21:32219594-32219616 TGGCATTCCAGGCACCACTGGGG - Intergenic
1178429533 21:32506841-32506863 TCGCATCCCCGGCCCCACTGTGG + Intronic
1179652569 21:42821150-42821172 TGGCATCCCTGGACCCACTTGGG + Intergenic
1179810219 21:43865280-43865302 TCGCCTCCGCGGCCCCGCTCTGG - Intronic
1179869131 21:44234252-44234274 TCTCAACCCCGGCCACACAGTGG - Intronic
1180843446 22:18969832-18969854 ACGCCCCCCCGGCCCCGCTGGGG + Intergenic
1182120333 22:27782249-27782271 TCCCTTCCCCGGCCCCACACCGG + Intronic
1183217549 22:36490586-36490608 TCGGAGCCCCGCCCCCAGTGTGG - Intronic
1184545318 22:45163687-45163709 GCGCATCGCCGGCCCCTCAGCGG + Intergenic
949683445 3:6541512-6541534 TGGCATTCCAGGCACCACTGGGG + Intergenic
949801228 3:7906358-7906380 TGGCATCCCCGGTGCCACTGGGG + Intergenic
949955021 3:9260267-9260289 TGGCATTCCAGGCACCACTGGGG - Intronic
950140188 3:10609897-10609919 TCCCATCCTCGGCCACAATGGGG + Intronic
950633238 3:14297985-14298007 CCGCATCCCCTGCCCATCTGCGG - Intergenic
951237745 3:20254711-20254733 TGGCATTCCAGGCGCCACTGGGG + Intergenic
953618191 3:44510646-44510668 TCGCCTCCCCGGGCCCTCTGCGG + Intergenic
954374151 3:50185400-50185422 CAGCATCCCCAGCCCCACTGAGG + Intronic
954454138 3:50587951-50587973 TCAGATCCCTGGGCCCACTGTGG - Intergenic
954978721 3:54723415-54723437 TGGCATTCCAGGCGCCACTGGGG + Intronic
955175141 3:56606298-56606320 TGGCATTCCAGGCACCACTGGGG + Intronic
956207755 3:66771845-66771867 TGGCATTCCAGGCGCCACTGGGG + Intergenic
956243370 3:67154390-67154412 TGGCATTCCAGGCACCACTGGGG - Intergenic
956300258 3:67764496-67764518 TGGCATTCCTGGCACCACTGGGG + Intergenic
956355686 3:68389976-68389998 TGGCATTCCAGGCACCACTGGGG - Intronic
956600069 3:71011235-71011257 TCTCATCCCCAGCCCCCATGTGG + Intronic
957046706 3:75381222-75381244 TCGCATCCCCGGCCCCACTGTGG - Intergenic
957256646 3:77845398-77845420 TGGCATTCCAGGCACCACTGGGG + Intergenic
958622247 3:96576285-96576307 TGGCATTCCAGGCGCCACTGGGG + Intergenic
959291862 3:104485066-104485088 TGGCATTCCCGGTGCCACTGTGG - Intergenic
960378155 3:116928308-116928330 TGGCATTCCAGGCACCACTGGGG + Intronic
960685629 3:120290656-120290678 TCGCGTCCCCTTCCGCACTGTGG + Intergenic
961310557 3:125996689-125996711 TGGCATTCCAGGCACCACTGGGG - Intergenic
961483361 3:127197855-127197877 CCGCATCCCTGGCCACCCTGTGG + Exonic
961878771 3:130045290-130045312 TCGCATCCCCGGCCCCACTGTGG - Intergenic
962415952 3:135182156-135182178 CCTCATACCCTGCCCCACTGAGG + Intronic
965618758 3:170621677-170621699 TGGCATTCCTGGCACCACTGGGG + Intronic
965880424 3:173382268-173382290 TGGCATTCCAGGCGCCACTGGGG - Intergenic
966572552 3:181461759-181461781 TCACATCCCCTGACCCTCTGGGG + Intergenic
967840916 3:194003803-194003825 TCCTAACCCAGGCCCCACTGCGG - Intergenic
968701074 4:2058697-2058719 CCGCATCCCCGTGCCCACTGCGG + Intergenic
968829140 4:2923160-2923182 TGGCATTCCAGGCGCCACTGGGG + Intronic
968990999 4:3912338-3912360 TCGCATCCCCGGCCCCACTGTGG - Intergenic
969824345 4:9745197-9745219 TCGCATCCCCGGCCCCACTGTGG + Intergenic
974161720 4:58149670-58149692 TAGCATTCCAGGCGCCACTGGGG - Intergenic
974491658 4:62571936-62571958 TGGCATTCCAGGCACCACTGGGG + Intergenic
975149450 4:71005004-71005026 TGGCATTCCAGGCACCACTGGGG + Intronic
976006766 4:80439661-80439683 TGGCATTCCAGGCACCACTGGGG - Intronic
976715907 4:88122283-88122305 TGGCATTCCAGGCACCACTGGGG - Intronic
976903549 4:90208526-90208548 TGGCATTCCAGGCACCACTGGGG + Intronic
979245855 4:118503397-118503419 TCTCATCTCCTTCCCCACTGTGG + Intergenic
981411226 4:144435046-144435068 TGGCATTCCAGGCGCCACTGGGG - Intergenic
981788014 4:148502901-148502923 TGGCATTCCAGGCGCCACTGGGG + Intergenic
981939901 4:150271333-150271355 TGGCATTCCAGGCACCACTGGGG - Intronic
982745929 4:159103806-159103828 ACGCCTCCCCGGCTCCACTCGGG - Intergenic
983334861 4:166378855-166378877 TCTCATCCCAGGAGCCACTGGGG + Intergenic
983788031 4:171759244-171759266 TGGCATTCCAGGCACCACTGGGG - Intergenic
983949485 4:173622576-173622598 TGGCATTCCAGGCACCACTGAGG + Intergenic
984269865 4:177537133-177537155 TGGCATTCCAGGCACCACTGGGG + Intergenic
985527562 5:414983-415005 TGGAAACCCCAGCCCCACTGAGG + Intronic
990351293 5:54919221-54919243 TGGCATTCCAGGCACCACTGGGG - Intergenic
993673925 5:90795116-90795138 TGGCATTCCAGGCACCACTGAGG - Intronic
993757657 5:91751235-91751257 TGGCATTCCAGGCGCCACTGGGG + Intergenic
994142891 5:96361353-96361375 TGGCATTCCAGGCACCACTGGGG + Intergenic
995111825 5:108437380-108437402 TGGCATTCCAGGCACCACTGGGG - Intergenic
995398735 5:111717212-111717234 TGGCATTCCAGGCACCACTGGGG + Intronic
995475009 5:112539073-112539095 TGGCATTCCAGGCACCACTGGGG - Intergenic
995586597 5:113654769-113654791 TAGCATCCCCCCCCCCACTTTGG + Intergenic
995612334 5:113923722-113923744 TGGCATTCCAGGCACCACTGGGG - Intergenic
996765290 5:127030068-127030090 ACGCGTCCCCTGCCCCTCTGCGG - Intronic
996978537 5:129461622-129461644 TCCCGGCCCCGGCCCCACGGGGG + Exonic
999818644 5:155201948-155201970 TTGCATCCCCTTCCACACTGTGG - Intergenic
1000376152 5:160584051-160584073 TGGCATTCCAGGCACCACTGGGG + Intronic
1001539521 5:172527550-172527572 TGGCATCTGTGGCCCCACTGAGG - Intergenic
1001650339 5:173311323-173311345 TCCCAGCCCCTGCCCCAGTGAGG - Intergenic
1002056287 5:176599594-176599616 CCCCTTCCCCAGCCCCACTGGGG + Exonic
1002474992 5:179459902-179459924 TCACTTCCCCGGCCCCTCTTGGG + Intergenic
1005274152 6:24198625-24198647 TGGCATTCCAGGCACCACTGGGG - Intronic
1006408538 6:33858737-33858759 CCGCATGCCCGGCACCGCTGGGG - Intergenic
1006978246 6:38123930-38123952 TCGCGTCCCCTTCCACACTGTGG - Intronic
1008425250 6:51349329-51349351 TGGCATTCCAGGCGCCACTGGGG + Intergenic
1008785083 6:55158423-55158445 TGGCATTCCAGGCACCACTGGGG - Intronic
1009685511 6:66950336-66950358 TCGGGTCCCCTGCCACACTGTGG + Intergenic
1010276308 6:73972223-73972245 TGGCATTCCAGGCACCACTGGGG - Intergenic
1011139254 6:84134368-84134390 TGGCATTCCAGGCGCCACTGTGG + Intronic
1011302676 6:85892655-85892677 TGGCATTCCAGGCACCACTGGGG + Intergenic
1013452961 6:110303282-110303304 TGGCATTCCAGGCACCACTGGGG - Intronic
1013964175 6:115935466-115935488 TGGCATTCCAGGCACCACTGGGG - Exonic
1014278807 6:119418060-119418082 TGGCATTCCAGGCACCACTGGGG - Intergenic
1014387099 6:120816216-120816238 TGGCATTCCAGGCGCCACTGGGG + Intergenic
1014922399 6:127228606-127228628 TGGCATTCCAGGCACCACTGGGG - Intergenic
1015883312 6:137891416-137891438 TGGCATTCCAGGCACCACTGGGG + Intergenic
1018108681 6:160513806-160513828 TGGCATCCCAGGCACCACTGGGG - Intergenic
1019331702 7:463602-463624 CCGCGGCCCCGGCCCCACTGCGG + Intergenic
1019427093 7:982998-983020 TCCCCTCCCCGGCCCCACCAGGG + Intergenic
1019778777 7:2927754-2927776 CCACACCCCCGGTCCCACTGGGG - Intronic
1020313828 7:6890218-6890240 TCGCACCCCCGGCCCCACTGTGG - Intergenic
1020428607 7:8096344-8096366 TGGCATTCCAGGCGCCACTGGGG - Intergenic
1021224591 7:18012860-18012882 TGGCATTCCAGGCGCCACTGGGG + Intergenic
1024056064 7:45660493-45660515 CCCCATCCCTGGCCCCCCTGCGG - Intronic
1024152943 7:46591146-46591168 TGGCATTCCAGGCACCACTGGGG - Intergenic
1024466054 7:49712159-49712181 TCGGATCCCCTTCCGCACTGTGG + Intergenic
1028099602 7:86803725-86803747 TCGCATCCCAAGCCCCAGTGTGG + Intronic
1030115378 7:106058784-106058806 TTGCAAGCCCTGCCCCACTGTGG + Intergenic
1031031805 7:116743345-116743367 TGGCATTCCAGGCACCACTGGGG - Intronic
1031902749 7:127428770-127428792 TGGCATTCCAGGCACCACTGGGG + Intronic
1032295960 7:130638750-130638772 TGGCATTCCAGGCGCCACTGAGG + Intronic
1032659787 7:133970367-133970389 TGGCATTCCAGGCACCACTGTGG + Intronic
1034398135 7:150842900-150842922 TGGCATCCCTGGACCCACTCAGG + Intronic
1034441368 7:151087445-151087467 TCCGATCCCCCGCCCCACTGCGG - Intronic
1035174958 7:157043999-157044021 ACGCATCTCTGGCCCCACTGGGG + Intergenic
1037258317 8:16979840-16979862 TAGCATTCCAGGCACCACTGGGG + Intergenic
1038316544 8:26489269-26489291 TCTCATCCTTGTCCCCACTGTGG + Intronic
1040354977 8:46608555-46608577 TGGCATTCCAGGCGCCACTGGGG - Intergenic
1041323337 8:56637338-56637360 TGGCATTCCAGGCACCACTGGGG + Intergenic
1041459776 8:58098566-58098588 TGGCATTCCAGGCACCACTGGGG + Intronic
1042169356 8:65977169-65977191 TCGGATCCCCTTCCACACTGTGG - Intergenic
1042443094 8:68850566-68850588 TCGCATCCCCTTCCACGCTGTGG - Intergenic
1042812939 8:72845962-72845984 TGGCATTCCAGGCACCACTGGGG + Intronic
1044534774 8:93345922-93345944 TCGGGTCCCCTTCCCCACTGTGG + Intergenic
1049284066 8:141765102-141765124 GAGCATCCCGGGCCCCACTGTGG + Intergenic
1050404456 9:5293194-5293216 TGGCATTCCAGGCACCACTGGGG - Intergenic
1050943183 9:11485786-11485808 TGGCATTCCAGGCACCACTGGGG + Intergenic
1052052749 9:23866624-23866646 TGGCATTCCAGGCACCACTGGGG + Intergenic
1052281249 9:26735596-26735618 TGGCATTCCAGGCACCACTGGGG + Intergenic
1054889094 9:70232625-70232647 TGGCATTCCAGGCACCACTGGGG - Intergenic
1057355086 9:94325713-94325735 TGGAAGCCCCGGCCCCACTCGGG + Exonic
1061135160 9:128729564-128729586 TCACATCCCTGTGCCCACTGAGG - Intergenic
1062094262 9:134694907-134694929 TGGGATCCACGTCCCCACTGGGG + Intronic
1186960980 X:14736257-14736279 TGGCATTCCAGGCACCACTGGGG + Intergenic
1187784285 X:22866798-22866820 TGGCATTCCAGGCGCCACTGGGG - Intergenic
1188893324 X:35636385-35636407 TGGCATTCCAGGCACCACTGGGG + Intergenic
1189243323 X:39542284-39542306 TGGCATTCCAGGCACCACTGGGG - Intergenic
1189575142 X:42343393-42343415 TGGCATTCCAGGCACCACTGGGG + Intergenic
1189590616 X:42507150-42507172 TGGCATTCCAGGCACCACTGGGG - Intergenic
1189937729 X:46087253-46087275 TGGCATTCCAGGCACCACTGGGG - Intergenic
1190341494 X:49300033-49300055 TGGCATTCCAGGCACCACTGGGG + Intronic
1190495119 X:51021088-51021110 TGGCATTCCAGGCGCCACTGGGG + Intergenic
1190505843 X:51125344-51125366 TGGCATTCCAGGCGCCACTGGGG - Intergenic
1191099005 X:56704954-56704976 TGGCATTCCAGGCGCCACTGGGG + Intergenic
1191601807 X:63016930-63016952 TGGCATTCCAGGCACCACTGGGG + Intergenic
1192674563 X:73182503-73182525 TGGCATTCCAGGCACCACTGTGG - Intergenic
1193266819 X:79482131-79482153 TGGCATTCCAGGCACCACTGGGG - Intergenic
1193334617 X:80273847-80273869 TGGCATTCCAGGCGCCACTGAGG - Intergenic
1194021229 X:88694632-88694654 TGGCATTCCAGGCGCCACTGGGG - Intergenic
1194119022 X:89937758-89937780 TGGCATTCCAGGCGCCACTGTGG + Intergenic
1194963975 X:100266946-100266968 TGGCATTCCAGGCACCACTGGGG - Intergenic
1195751155 X:108162925-108162947 TGGCATCCCTGGCCTCACTGGGG - Exonic
1197051155 X:122061151-122061173 TGGCATTCCAGGCACCACTGGGG - Intergenic
1197906215 X:131428382-131428404 TGGCATTCCAGGCGCCACTGGGG - Intergenic
1199094444 X:143723594-143723616 TAGCATTCCAGGCGCCACTGGGG - Intergenic
1199477395 X:148260427-148260449 TGGCATTCCAGGCACCACTGGGG + Intergenic
1199522206 X:148748781-148748803 TTCCATCCCCGTCCCCACTATGG - Intronic
1199701416 X:150379444-150379466 TCATCTCCCGGGCCCCACTGAGG + Intronic
1200388524 X:155918329-155918351 TGGCATTCCAGGCGCCACTGGGG + Intronic
1200471898 Y:3595312-3595334 TGGCATTCCAGGCGCCACTGTGG + Intergenic
1201848580 Y:18451244-18451266 TAGCATTCCAGGCACCACTGGGG + Intergenic
1201884737 Y:18869131-18869153 TAGCATTCCAGGCACCACTGGGG - Intergenic
1202335154 Y:23801123-23801145 TAGCATTCCAGGCACCACTGCGG - Intergenic
1202535613 Y:25868936-25868958 TAGCATTCCAGGCACCACTGCGG + Intergenic