ID: 957048807

View in Genome Browser
Species Human (GRCh38)
Location 3:75396257-75396279
Sequence CCGGGCATGGGCTTCGGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957048807_957048819 14 Left 957048807 3:75396257-75396279 CCCGGGCCGAAGCCCATGCCCGG No data
Right 957048819 3:75396294-75396316 ACTACCTGACTTGCCGCGGCTGG No data
957048807_957048820 15 Left 957048807 3:75396257-75396279 CCCGGGCCGAAGCCCATGCCCGG No data
Right 957048820 3:75396295-75396317 CTACCTGACTTGCCGCGGCTGGG No data
957048807_957048823 26 Left 957048807 3:75396257-75396279 CCCGGGCCGAAGCCCATGCCCGG No data
Right 957048823 3:75396306-75396328 GCCGCGGCTGGGCTGGCCCCCGG No data
957048807_957048826 28 Left 957048807 3:75396257-75396279 CCCGGGCCGAAGCCCATGCCCGG No data
Right 957048826 3:75396308-75396330 CGCGGCTGGGCTGGCCCCCGGGG No data
957048807_957048825 27 Left 957048807 3:75396257-75396279 CCCGGGCCGAAGCCCATGCCCGG No data
Right 957048825 3:75396307-75396329 CCGCGGCTGGGCTGGCCCCCGGG No data
957048807_957048822 19 Left 957048807 3:75396257-75396279 CCCGGGCCGAAGCCCATGCCCGG No data
Right 957048822 3:75396299-75396321 CTGACTTGCCGCGGCTGGGCTGG No data
957048807_957048818 10 Left 957048807 3:75396257-75396279 CCCGGGCCGAAGCCCATGCCCGG No data
Right 957048818 3:75396290-75396312 GCAGACTACCTGACTTGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957048807 Original CRISPR CCGGGCATGGGCTTCGGCCC GGG (reversed) Intergenic