ID: 957048819

View in Genome Browser
Species Human (GRCh38)
Location 3:75396294-75396316
Sequence ACTACCTGACTTGCCGCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957048804_957048819 24 Left 957048804 3:75396247-75396269 CCTCCTGCACCCCGGGCCGAAGC No data
Right 957048819 3:75396294-75396316 ACTACCTGACTTGCCGCGGCTGG No data
957048812_957048819 1 Left 957048812 3:75396270-75396292 CCATGCCCGGAGCTCCCGCCGCA No data
Right 957048819 3:75396294-75396316 ACTACCTGACTTGCCGCGGCTGG No data
957048806_957048819 15 Left 957048806 3:75396256-75396278 CCCCGGGCCGAAGCCCATGCCCG No data
Right 957048819 3:75396294-75396316 ACTACCTGACTTGCCGCGGCTGG No data
957048811_957048819 2 Left 957048811 3:75396269-75396291 CCCATGCCCGGAGCTCCCGCCGC No data
Right 957048819 3:75396294-75396316 ACTACCTGACTTGCCGCGGCTGG No data
957048814_957048819 -5 Left 957048814 3:75396276-75396298 CCGGAGCTCCCGCCGCAGACTAC No data
Right 957048819 3:75396294-75396316 ACTACCTGACTTGCCGCGGCTGG No data
957048813_957048819 -4 Left 957048813 3:75396275-75396297 CCCGGAGCTCCCGCCGCAGACTA No data
Right 957048819 3:75396294-75396316 ACTACCTGACTTGCCGCGGCTGG No data
957048807_957048819 14 Left 957048807 3:75396257-75396279 CCCGGGCCGAAGCCCATGCCCGG No data
Right 957048819 3:75396294-75396316 ACTACCTGACTTGCCGCGGCTGG No data
957048809_957048819 13 Left 957048809 3:75396258-75396280 CCGGGCCGAAGCCCATGCCCGGA No data
Right 957048819 3:75396294-75396316 ACTACCTGACTTGCCGCGGCTGG No data
957048810_957048819 8 Left 957048810 3:75396263-75396285 CCGAAGCCCATGCCCGGAGCTCC No data
Right 957048819 3:75396294-75396316 ACTACCTGACTTGCCGCGGCTGG No data
957048805_957048819 21 Left 957048805 3:75396250-75396272 CCTGCACCCCGGGCCGAAGCCCA No data
Right 957048819 3:75396294-75396316 ACTACCTGACTTGCCGCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957048819 Original CRISPR ACTACCTGACTTGCCGCGGC TGG Intergenic