ID: 957048825

View in Genome Browser
Species Human (GRCh38)
Location 3:75396307-75396329
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957048812_957048825 14 Left 957048812 3:75396270-75396292 CCATGCCCGGAGCTCCCGCCGCA No data
Right 957048825 3:75396307-75396329 CCGCGGCTGGGCTGGCCCCCGGG No data
957048810_957048825 21 Left 957048810 3:75396263-75396285 CCGAAGCCCATGCCCGGAGCTCC No data
Right 957048825 3:75396307-75396329 CCGCGGCTGGGCTGGCCCCCGGG No data
957048809_957048825 26 Left 957048809 3:75396258-75396280 CCGGGCCGAAGCCCATGCCCGGA No data
Right 957048825 3:75396307-75396329 CCGCGGCTGGGCTGGCCCCCGGG No data
957048806_957048825 28 Left 957048806 3:75396256-75396278 CCCCGGGCCGAAGCCCATGCCCG No data
Right 957048825 3:75396307-75396329 CCGCGGCTGGGCTGGCCCCCGGG No data
957048813_957048825 9 Left 957048813 3:75396275-75396297 CCCGGAGCTCCCGCCGCAGACTA No data
Right 957048825 3:75396307-75396329 CCGCGGCTGGGCTGGCCCCCGGG No data
957048807_957048825 27 Left 957048807 3:75396257-75396279 CCCGGGCCGAAGCCCATGCCCGG No data
Right 957048825 3:75396307-75396329 CCGCGGCTGGGCTGGCCCCCGGG No data
957048815_957048825 0 Left 957048815 3:75396284-75396306 CCCGCCGCAGACTACCTGACTTG No data
Right 957048825 3:75396307-75396329 CCGCGGCTGGGCTGGCCCCCGGG No data
957048811_957048825 15 Left 957048811 3:75396269-75396291 CCCATGCCCGGAGCTCCCGCCGC No data
Right 957048825 3:75396307-75396329 CCGCGGCTGGGCTGGCCCCCGGG No data
957048814_957048825 8 Left 957048814 3:75396276-75396298 CCGGAGCTCCCGCCGCAGACTAC No data
Right 957048825 3:75396307-75396329 CCGCGGCTGGGCTGGCCCCCGGG No data
957048817_957048825 -4 Left 957048817 3:75396288-75396310 CCGCAGACTACCTGACTTGCCGC No data
Right 957048825 3:75396307-75396329 CCGCGGCTGGGCTGGCCCCCGGG No data
957048816_957048825 -1 Left 957048816 3:75396285-75396307 CCGCCGCAGACTACCTGACTTGC No data
Right 957048825 3:75396307-75396329 CCGCGGCTGGGCTGGCCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type