ID: 957052517 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:75421290-75421312 |
| Sequence | CTGCAGTTTAGGAAGTGATC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 957052509_957052517 | 9 | Left | 957052509 | 3:75421258-75421280 | CCACAAATGATGCTGGATCCAGG | No data | ||
| Right | 957052517 | 3:75421290-75421312 | CTGCAGTTTAGGAAGTGATCAGG | No data | ||||
| 957052514_957052517 | -9 | Left | 957052514 | 3:75421276-75421298 | CCAGGTGGGCCAGGCTGCAGTTT | No data | ||
| Right | 957052517 | 3:75421290-75421312 | CTGCAGTTTAGGAAGTGATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 957052517 | Original CRISPR | CTGCAGTTTAGGAAGTGATC AGG | Intergenic | ||
| No off target data available for this crispr | |||||