ID: 957052517

View in Genome Browser
Species Human (GRCh38)
Location 3:75421290-75421312
Sequence CTGCAGTTTAGGAAGTGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957052509_957052517 9 Left 957052509 3:75421258-75421280 CCACAAATGATGCTGGATCCAGG No data
Right 957052517 3:75421290-75421312 CTGCAGTTTAGGAAGTGATCAGG No data
957052514_957052517 -9 Left 957052514 3:75421276-75421298 CCAGGTGGGCCAGGCTGCAGTTT No data
Right 957052517 3:75421290-75421312 CTGCAGTTTAGGAAGTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957052517 Original CRISPR CTGCAGTTTAGGAAGTGATC AGG Intergenic
No off target data available for this crispr