ID: 957054741

View in Genome Browser
Species Human (GRCh38)
Location 3:75435087-75435109
Sequence TGGCGCCCGAGGAGAATGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 6, 2: 3, 3: 6, 4: 37}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957054741_957054756 18 Left 957054741 3:75435087-75435109 CCCCGCATTCTCCTCGGGCGCCA 0: 1
1: 6
2: 3
3: 6
4: 37
Right 957054756 3:75435128-75435150 AGCGTTGCCGGGAGACCGGGCGG No data
957054741_957054758 25 Left 957054741 3:75435087-75435109 CCCCGCATTCTCCTCGGGCGCCA 0: 1
1: 6
2: 3
3: 6
4: 37
Right 957054758 3:75435135-75435157 CCGGGAGACCGGGCGGAAGCCGG No data
957054741_957054759 26 Left 957054741 3:75435087-75435109 CCCCGCATTCTCCTCGGGCGCCA 0: 1
1: 6
2: 3
3: 6
4: 37
Right 957054759 3:75435136-75435158 CGGGAGACCGGGCGGAAGCCGGG No data
957054741_957054749 -9 Left 957054741 3:75435087-75435109 CCCCGCATTCTCCTCGGGCGCCA 0: 1
1: 6
2: 3
3: 6
4: 37
Right 957054749 3:75435101-75435123 CGGGCGCCATGACGTGGGCGGGG No data
957054741_957054748 -10 Left 957054741 3:75435087-75435109 CCCCGCATTCTCCTCGGGCGCCA 0: 1
1: 6
2: 3
3: 6
4: 37
Right 957054748 3:75435100-75435122 TCGGGCGCCATGACGTGGGCGGG No data
957054741_957054751 6 Left 957054741 3:75435087-75435109 CCCCGCATTCTCCTCGGGCGCCA 0: 1
1: 6
2: 3
3: 6
4: 37
Right 957054751 3:75435116-75435138 GGGCGGGGCCGCAGCGTTGCCGG No data
957054741_957054752 7 Left 957054741 3:75435087-75435109 CCCCGCATTCTCCTCGGGCGCCA 0: 1
1: 6
2: 3
3: 6
4: 37
Right 957054752 3:75435117-75435139 GGCGGGGCCGCAGCGTTGCCGGG No data
957054741_957054755 15 Left 957054741 3:75435087-75435109 CCCCGCATTCTCCTCGGGCGCCA 0: 1
1: 6
2: 3
3: 6
4: 37
Right 957054755 3:75435125-75435147 CGCAGCGTTGCCGGGAGACCGGG No data
957054741_957054754 14 Left 957054741 3:75435087-75435109 CCCCGCATTCTCCTCGGGCGCCA 0: 1
1: 6
2: 3
3: 6
4: 37
Right 957054754 3:75435124-75435146 CCGCAGCGTTGCCGGGAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957054741 Original CRISPR TGGCGCCCGAGGAGAATGCG GGG (reversed) Intergenic