ID: 957060973

View in Genome Browser
Species Human (GRCh38)
Location 3:75481106-75481128
Sequence ACTACCTCCTGCACTTGTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957060973_957060980 12 Left 957060973 3:75481106-75481128 CCCCGACAAGTGCAGGAGGTAGT No data
Right 957060980 3:75481141-75481163 GCACTTCCATTTCAGACTGCTGG No data
957060973_957060982 25 Left 957060973 3:75481106-75481128 CCCCGACAAGTGCAGGAGGTAGT No data
Right 957060982 3:75481154-75481176 AGACTGCTGGCCACCAGAGCCGG No data
957060973_957060977 -10 Left 957060973 3:75481106-75481128 CCCCGACAAGTGCAGGAGGTAGT No data
Right 957060977 3:75481119-75481141 AGGAGGTAGTGTGGCCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957060973 Original CRISPR ACTACCTCCTGCACTTGTCG GGG (reversed) Intergenic