ID: 957060977

View in Genome Browser
Species Human (GRCh38)
Location 3:75481119-75481141
Sequence AGGAGGTAGTGTGGCCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957060973_957060977 -10 Left 957060973 3:75481106-75481128 CCCCGACAAGTGCAGGAGGTAGT No data
Right 957060977 3:75481119-75481141 AGGAGGTAGTGTGGCCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957060977 Original CRISPR AGGAGGTAGTGTGGCCCTGC TGG Intergenic