ID: 957060980

View in Genome Browser
Species Human (GRCh38)
Location 3:75481141-75481163
Sequence GCACTTCCATTTCAGACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957060975_957060980 10 Left 957060975 3:75481108-75481130 CCGACAAGTGCAGGAGGTAGTGT No data
Right 957060980 3:75481141-75481163 GCACTTCCATTTCAGACTGCTGG No data
957060974_957060980 11 Left 957060974 3:75481107-75481129 CCCGACAAGTGCAGGAGGTAGTG No data
Right 957060980 3:75481141-75481163 GCACTTCCATTTCAGACTGCTGG No data
957060973_957060980 12 Left 957060973 3:75481106-75481128 CCCCGACAAGTGCAGGAGGTAGT No data
Right 957060980 3:75481141-75481163 GCACTTCCATTTCAGACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957060980 Original CRISPR GCACTTCCATTTCAGACTGC TGG Intergenic